Incidental Mutation 'R4836:Map1b'
ID 373267
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, Mtap-5, MAP5, Mtap5, LC1
MMRRC Submission 042451-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4836 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 99557954-99653048 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99567562 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1720 (S1720P)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: S1720P
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: S1720P

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224702
Meta Mutation Damage Score 0.0750 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 A T 11: 116,066,152 (GRCm39) S453T probably benign Het
Ahnak2 A T 12: 112,740,550 (GRCm39) V368D probably damaging Het
Ankrd53 A T 6: 83,745,134 (GRCm39) Y448F probably damaging Het
Arhgef15 A T 11: 68,840,751 (GRCm39) probably benign Het
Atg2b T C 12: 105,613,073 (GRCm39) N1166S probably benign Het
Atl3 C T 19: 7,486,910 (GRCm39) R77* probably null Het
Bend6 T C 1: 33,922,654 (GRCm39) probably benign Het
Ccnt1 C A 15: 98,465,444 (GRCm39) R25L probably damaging Het
Cct4 A G 11: 22,952,898 (GRCm39) T525A probably benign Het
Cep350 T C 1: 155,804,579 (GRCm39) I835V probably damaging Het
Cimap2 T A 4: 106,467,724 (GRCm39) probably null Het
Clcn1 G T 6: 42,286,898 (GRCm39) V652L probably damaging Het
Cntln T A 4: 84,967,957 (GRCm39) Y725* probably null Het
Cog5 T C 12: 31,969,732 (GRCm39) F21L probably benign Het
D6Ertd527e GGCAGCAGCAGCA GGCAGCAGCAGCAGCA 6: 87,088,406 (GRCm39) probably benign Het
Dnm2 A T 9: 21,402,626 (GRCm39) probably benign Het
Dnmt1 C T 9: 20,819,854 (GRCm39) V1430I probably damaging Het
Dpep1 A G 8: 123,927,106 (GRCm39) D285G probably damaging Het
Eef2kmt C T 16: 5,066,867 (GRCm39) V129M probably damaging Het
Epha3 A T 16: 63,403,920 (GRCm39) M726K probably damaging Het
Fat3 A G 9: 16,289,019 (GRCm39) L168P probably damaging Het
Frem3 T A 8: 81,390,026 (GRCm39) F1759Y probably damaging Het
Fubp3 T A 2: 31,498,153 (GRCm39) S56R possibly damaging Het
Gm1965 T C 6: 89,122,392 (GRCm39) noncoding transcript Het
Gm5592 C T 7: 40,864,958 (GRCm39) probably benign Het
H1f9 T A 11: 94,858,843 (GRCm39) L46* probably null Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,265,453 (GRCm39) 913 probably null Het
Isl1 A G 13: 116,439,619 (GRCm39) M243T probably benign Het
Itpr1 A T 6: 108,366,498 (GRCm39) I142F probably damaging Het
Jak1 T C 4: 101,012,263 (GRCm39) T1069A probably damaging Het
Jmjd1c T C 10: 67,069,225 (GRCm39) V1848A probably benign Het
Kdm5a T C 6: 120,389,363 (GRCm39) V930A probably damaging Het
Kdm5b C A 1: 134,521,053 (GRCm39) probably null Het
Lilra5 T C 7: 4,241,713 (GRCm39) F171L possibly damaging Het
Mcpt1 A T 14: 56,257,017 (GRCm39) Q185L probably damaging Het
Mmp20 T A 9: 7,644,027 (GRCm39) D238E possibly damaging Het
Mov10l1 A T 15: 88,904,472 (GRCm39) I784F possibly damaging Het
Mroh2b C T 15: 4,933,752 (GRCm39) P101S probably damaging Het
Myh3 G T 11: 66,987,765 (GRCm39) A1413S probably benign Het
Naa80 A T 9: 107,460,738 (GRCm39) Y211F probably damaging Het
Npdc1 G A 2: 25,298,957 (GRCm39) D284N probably damaging Het
Or12j4 A G 7: 140,046,989 (GRCm39) R292G probably damaging Het
Or2t48 A C 11: 58,420,308 (GRCm39) M168R probably damaging Het
Or4a66 A G 2: 88,531,544 (GRCm39) I43T probably damaging Het
Or5g9 A G 2: 85,551,793 (GRCm39) I15V probably benign Het
Or8k22 A T 2: 86,163,571 (GRCm39) M43K probably benign Het
Or8k23 G A 2: 86,186,094 (GRCm39) L211F probably benign Het
Palld T A 8: 62,140,415 (GRCm39) T531S probably benign Het
Parp4 A G 14: 56,823,195 (GRCm39) E105G probably benign Het
Phf11a A T 14: 59,525,028 (GRCm39) S59T probably damaging Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Rad50 A T 11: 53,541,480 (GRCm39) I1252N probably damaging Het
Ramp3 A G 11: 6,624,761 (GRCm39) probably null Het
Rrbp1 G A 2: 143,830,337 (GRCm39) T610I possibly damaging Het
Scart2 T C 7: 139,879,021 (GRCm39) I1051T probably benign Het
Semp2l2a C T 8: 13,888,007 (GRCm39) S28N probably benign Het
Slc4a10 A G 2: 62,098,531 (GRCm39) Y555C probably damaging Het
Slc5a2 A G 7: 127,866,677 (GRCm39) probably null Het
Smoc1 T A 12: 81,226,322 (GRCm39) D371E probably damaging Het
Stmn1 T A 4: 134,197,495 (GRCm39) probably benign Het
Sulf1 C T 1: 12,912,910 (GRCm39) L715F probably benign Het
Surf1 T C 2: 26,804,255 (GRCm39) T180A possibly damaging Het
Syne2 A G 12: 76,026,593 (GRCm39) I3474V probably damaging Het
Tchh A T 3: 93,352,455 (GRCm39) R632W unknown Het
Tchh A T 3: 93,354,895 (GRCm39) D1445V unknown Het
Tctn1 A T 5: 122,383,568 (GRCm39) M505K probably benign Het
Tdrkh T A 3: 94,332,897 (GRCm39) I150N probably damaging Het
Tespa1 C T 10: 130,198,028 (GRCm39) T350I probably benign Het
Thbs1 A G 2: 117,945,499 (GRCm39) Y326C possibly damaging Het
Tmem208 C T 8: 106,055,296 (GRCm39) S119F probably damaging Het
Tmprss6 G C 15: 78,329,588 (GRCm39) A91G probably damaging Het
Trp53bp2 C T 1: 182,259,147 (GRCm39) R67W probably damaging Het
Ttn A G 2: 76,541,541 (GRCm39) I25488T possibly damaging Het
Txnl4a A G 18: 80,265,468 (GRCm39) E111G probably damaging Het
Unc13b T G 4: 43,237,137 (GRCm39) I3402M probably damaging Het
Vmn1r188 A C 13: 22,272,291 (GRCm39) I82L probably benign Het
Zfp65 A G 13: 67,856,994 (GRCm39) V95A probably benign Het
Zfp985 T A 4: 147,668,612 (GRCm39) S493R probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99,565,741 (GRCm39) missense unknown
IGL00533:Map1b APN 13 99,569,112 (GRCm39) missense unknown
IGL00801:Map1b APN 13 99,566,605 (GRCm39) missense unknown
IGL01141:Map1b APN 13 99,571,269 (GRCm39) missense probably damaging 1.00
IGL01418:Map1b APN 13 99,568,338 (GRCm39) missense unknown
IGL01464:Map1b APN 13 99,569,251 (GRCm39) missense unknown
IGL01690:Map1b APN 13 99,571,512 (GRCm39) missense probably damaging 1.00
IGL01991:Map1b APN 13 99,566,077 (GRCm39) missense unknown
IGL02245:Map1b APN 13 99,568,036 (GRCm39) missense unknown
IGL02376:Map1b APN 13 99,572,103 (GRCm39) missense probably damaging 1.00
IGL02380:Map1b APN 13 99,567,651 (GRCm39) missense unknown
IGL02442:Map1b APN 13 99,644,706 (GRCm39) missense probably damaging 1.00
IGL02465:Map1b APN 13 99,569,914 (GRCm39) missense unknown
IGL02816:Map1b APN 13 99,578,263 (GRCm39) missense probably damaging 1.00
IGL02859:Map1b APN 13 99,569,544 (GRCm39) missense unknown
IGL02934:Map1b APN 13 99,571,639 (GRCm39) missense probably benign 0.09
IGL02970:Map1b APN 13 99,567,242 (GRCm39) nonsense probably null
IGL03148:Map1b APN 13 99,578,203 (GRCm39) missense probably damaging 1.00
IGL03401:Map1b APN 13 99,563,776 (GRCm39) missense unknown
IGL03138:Map1b UTSW 13 99,562,334 (GRCm39) missense unknown
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0035:Map1b UTSW 13 99,571,846 (GRCm39) missense probably damaging 1.00
R0069:Map1b UTSW 13 99,566,356 (GRCm39) missense unknown
R0315:Map1b UTSW 13 99,567,624 (GRCm39) missense unknown
R0539:Map1b UTSW 13 99,570,526 (GRCm39) missense unknown
R0548:Map1b UTSW 13 99,568,191 (GRCm39) missense unknown
R0613:Map1b UTSW 13 99,578,149 (GRCm39) missense probably damaging 1.00
R0730:Map1b UTSW 13 99,566,274 (GRCm39) nonsense probably null
R1103:Map1b UTSW 13 99,563,974 (GRCm39) splice site probably benign
R1300:Map1b UTSW 13 99,569,029 (GRCm39) missense unknown
R1353:Map1b UTSW 13 99,563,834 (GRCm39) missense unknown
R1387:Map1b UTSW 13 99,569,158 (GRCm39) missense unknown
R1481:Map1b UTSW 13 99,567,679 (GRCm39) missense unknown
R1509:Map1b UTSW 13 99,568,036 (GRCm39) missense unknown
R1521:Map1b UTSW 13 99,569,247 (GRCm39) missense unknown
R1604:Map1b UTSW 13 99,566,080 (GRCm39) missense unknown
R1649:Map1b UTSW 13 99,652,986 (GRCm39) missense probably benign 0.03
R1651:Map1b UTSW 13 99,569,091 (GRCm39) missense unknown
R1661:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1665:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1770:Map1b UTSW 13 99,567,001 (GRCm39) missense unknown
R1926:Map1b UTSW 13 99,567,200 (GRCm39) missense unknown
R1928:Map1b UTSW 13 99,567,454 (GRCm39) missense unknown
R2093:Map1b UTSW 13 99,566,178 (GRCm39) missense unknown
R2110:Map1b UTSW 13 99,567,629 (GRCm39) missense unknown
R2116:Map1b UTSW 13 99,567,152 (GRCm39) missense unknown
R2164:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R2207:Map1b UTSW 13 99,567,591 (GRCm39) missense unknown
R2273:Map1b UTSW 13 99,568,592 (GRCm39) missense unknown
R2443:Map1b UTSW 13 99,566,919 (GRCm39) missense unknown
R3054:Map1b UTSW 13 99,569,250 (GRCm39) missense unknown
R3766:Map1b UTSW 13 99,570,595 (GRCm39) missense unknown
R3911:Map1b UTSW 13 99,567,580 (GRCm39) missense unknown
R4005:Map1b UTSW 13 99,566,415 (GRCm39) missense unknown
R4130:Map1b UTSW 13 99,568,188 (GRCm39) missense unknown
R4513:Map1b UTSW 13 99,580,741 (GRCm39) missense probably damaging 1.00
R4613:Map1b UTSW 13 99,566,810 (GRCm39) nonsense probably null
R4633:Map1b UTSW 13 99,571,450 (GRCm39) missense probably damaging 1.00
R4646:Map1b UTSW 13 99,568,977 (GRCm39) missense unknown
R4690:Map1b UTSW 13 99,567,576 (GRCm39) missense unknown
R4704:Map1b UTSW 13 99,566,983 (GRCm39) missense unknown
R4916:Map1b UTSW 13 99,569,808 (GRCm39) missense unknown
R4951:Map1b UTSW 13 99,568,935 (GRCm39) missense unknown
R4960:Map1b UTSW 13 99,568,720 (GRCm39) missense probably benign 0.23
R4961:Map1b UTSW 13 99,572,161 (GRCm39) missense probably damaging 1.00
R5030:Map1b UTSW 13 99,570,682 (GRCm39) missense unknown
R5090:Map1b UTSW 13 99,566,534 (GRCm39) nonsense probably null
R5469:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R5820:Map1b UTSW 13 99,569,332 (GRCm39) missense unknown
R5885:Map1b UTSW 13 99,566,589 (GRCm39) missense unknown
R5915:Map1b UTSW 13 99,566,839 (GRCm39) missense unknown
R5923:Map1b UTSW 13 99,569,661 (GRCm39) missense unknown
R6063:Map1b UTSW 13 99,567,645 (GRCm39) missense unknown
R6102:Map1b UTSW 13 99,562,381 (GRCm39) missense unknown
R6218:Map1b UTSW 13 99,569,714 (GRCm39) missense unknown
R6435:Map1b UTSW 13 99,652,871 (GRCm39) missense probably damaging 0.99
R6663:Map1b UTSW 13 99,566,530 (GRCm39) missense unknown
R6765:Map1b UTSW 13 99,562,449 (GRCm39) missense unknown
R6860:Map1b UTSW 13 99,571,275 (GRCm39) missense probably damaging 1.00
R6997:Map1b UTSW 13 99,567,142 (GRCm39) missense unknown
R7001:Map1b UTSW 13 99,567,101 (GRCm39) missense unknown
R7310:Map1b UTSW 13 99,570,163 (GRCm39) missense unknown
R7349:Map1b UTSW 13 99,570,148 (GRCm39) missense unknown
R7448:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7449:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7452:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7810:Map1b UTSW 13 99,568,390 (GRCm39) missense unknown
R7820:Map1b UTSW 13 99,567,685 (GRCm39) missense unknown
R8396:Map1b UTSW 13 99,570,621 (GRCm39) missense unknown
R8470:Map1b UTSW 13 99,652,950 (GRCm39) missense probably damaging 0.98
R8535:Map1b UTSW 13 99,571,662 (GRCm39) missense probably damaging 1.00
R8777:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8777-TAIL:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8812:Map1b UTSW 13 99,569,323 (GRCm39) missense unknown
R8903:Map1b UTSW 13 99,569,017 (GRCm39) nonsense probably null
R8928:Map1b UTSW 13 99,568,624 (GRCm39) missense unknown
R8954:Map1b UTSW 13 99,570,735 (GRCm39) missense unknown
R9164:Map1b UTSW 13 99,568,816 (GRCm39) nonsense probably null
R9164:Map1b UTSW 13 99,562,351 (GRCm39) missense unknown
R9190:Map1b UTSW 13 99,571,914 (GRCm39) missense probably damaging 0.99
R9334:Map1b UTSW 13 99,568,148 (GRCm39) missense unknown
R9339:Map1b UTSW 13 99,567,570 (GRCm39) missense unknown
R9357:Map1b UTSW 13 99,566,708 (GRCm39) nonsense probably null
R9430:Map1b UTSW 13 99,570,616 (GRCm39) missense unknown
RF003:Map1b UTSW 13 99,567,258 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,568,920 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,566,476 (GRCm39) missense unknown
Z1088:Map1b UTSW 13 99,644,623 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATAAAGGTGAGGACTCTCGTGG -3'
(R):5'- TTTAGTCGGCAGTCTCCAGATC -3'

Sequencing Primer
(F):5'- ATATCAGATTTCGGAGAGAGCTTC -3'
(R):5'- AGTCTCCAGATCACCCTACTCTGG -3'
Posted On 2016-03-01