Incidental Mutation 'R4847:Epha1'
ID373300
Institutional Source Beutler Lab
Gene Symbol Epha1
Ensembl Gene ENSMUSG00000029859
Gene NameEph receptor A1
SynonymsEph, 5730453L17Rik, Esk
MMRRC Submission 042460-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4847 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42358487-42373268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42361914 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 687 (D687V)
Ref Sequence ENSEMBL: ENSMUSP00000144763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070635] [ENSMUST00000073387] [ENSMUST00000164375] [ENSMUST00000203401] [ENSMUST00000203652] [ENSMUST00000204357]
Predicted Effect probably benign
Transcript: ENSMUST00000070635
SMART Domains Protein: ENSMUSP00000070427
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073387
AA Change: D650V

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073099
Gene: ENSMUSG00000029859
AA Change: D650V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 3.23e-103 SMART
FN3 334 430 8.43e-9 SMART
FN3 448 526 1.59e-4 SMART
Pfam:EphA2_TM 549 622 3.4e-13 PFAM
TyrKc 625 881 2.57e-126 SMART
SAM 911 977 4.13e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164375
SMART Domains Protein: ENSMUSP00000126622
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203290
Predicted Effect probably benign
Transcript: ENSMUST00000203401
SMART Domains Protein: ENSMUSP00000145236
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 168 189 N/A INTRINSIC
low complexity region 219 235 N/A INTRINSIC
low complexity region 238 252 N/A INTRINSIC
low complexity region 292 302 N/A INTRINSIC
low complexity region 312 332 N/A INTRINSIC
LIM 344 397 2.4e-17 SMART
LIM 404 456 7.39e-18 SMART
LIM 464 526 9.31e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203652
SMART Domains Protein: ENSMUSP00000145451
Gene: ENSMUSG00000029860

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 61 84 N/A INTRINSIC
low complexity region 92 131 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
low complexity region 199 220 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 269 283 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
LIM 375 428 2.4e-17 SMART
LIM 435 487 7.39e-18 SMART
LIM 495 557 9.31e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000204357
AA Change: D687V

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144763
Gene: ENSMUSG00000029859
AA Change: D687V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 1.1e-105 SMART
FN3 334 430 4.2e-11 SMART
low complexity region 459 473 N/A INTRINSIC
FN3 483 563 2.4e-8 SMART
Pfam:EphA2_TM 586 659 7.6e-11 PFAM
STYKc 662 849 1.1e-65 SMART
SAM 879 945 2.5e-21 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene is expressed in some human cancer cell lines and has been implicated in carcinogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a null allele exhibit a kinked tail while 18% of mice exhibit vagina atresia with hydrometrocolops and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik C T 11: 80,374,114 V171M probably damaging Het
Abhd3 A G 18: 10,647,786 S328P possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aldh1b1 G T 4: 45,802,625 K54N possibly damaging Het
Amacr C T 15: 10,994,872 Q257* probably null Het
Ankrd12 A T 17: 66,024,092 D309E probably benign Het
Anks6 T C 4: 47,033,266 T600A probably benign Het
Ap3b1 A G 13: 94,471,779 E586G probably benign Het
Atad2b A G 12: 4,944,901 probably null Het
Cant1 G A 11: 118,410,110 Q240* probably null Het
Casc1 T A 6: 145,175,185 H636L probably damaging Het
Cep152 T C 2: 125,618,474 Y186C possibly damaging Het
Cep76 C A 18: 67,619,569 R603I probably benign Het
Chad T C 11: 94,568,327 S352P probably benign Het
Ckap2 T C 8: 22,175,068 E460G probably damaging Het
Col22a1 T C 15: 71,799,499 Y1004C unknown Het
Col9a3 G A 2: 180,615,525 G480S probably damaging Het
Cpsf2 A G 12: 101,997,302 D430G probably benign Het
Cramp1l T C 17: 24,985,089 D305G probably damaging Het
Ctnnd1 C A 2: 84,622,052 E76* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c39 A T 19: 39,560,896 N286I probably damaging Het
Ddx11 A G 17: 66,130,801 E174G probably damaging Het
Ddx19a T C 8: 110,977,045 E369G probably damaging Het
Fgr T C 4: 132,994,648 W132R probably damaging Het
Fras1 A T 5: 96,544,992 D170V possibly damaging Het
Gas2l1 A G 11: 5,064,173 S96P probably damaging Het
Gfy G A 7: 45,177,596 P359S probably damaging Het
Hexim2 A G 11: 103,138,941 N273S probably benign Het
Hr A T 14: 70,556,476 T59S probably benign Het
Impdh2 A G 9: 108,564,671 Y166C probably damaging Het
Impdh2 T A 9: 108,565,515 F514Y probably benign Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Klhl17 A T 4: 156,231,597 H433Q probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kntc1 A C 5: 123,802,274 N1645T probably benign Het
Mcm8 A G 2: 132,820,003 I114V probably benign Het
Mink1 T A 11: 70,602,028 L160Q probably damaging Het
Mipol1 A T 12: 57,303,496 S27C probably damaging Het
Mthfr T C 4: 148,048,139 V217A probably damaging Het
Olfr1458 A G 19: 13,102,534 Y257H probably damaging Het
Olfr473 T A 7: 107,933,827 C102* probably null Het
Pde1c T C 6: 56,123,034 K614E possibly damaging Het
Pds5b A T 5: 150,748,112 E407V probably damaging Het
Pdzph1 A G 17: 58,973,530 S586P possibly damaging Het
Prkcb C T 7: 122,568,149 R361W probably benign Het
Psen2 T A 1: 180,245,632 probably null Het
Ptk2 T A 15: 73,231,956 M82L probably benign Het
Ptk2b T C 14: 66,173,882 D400G probably damaging Het
Samd8 G A 14: 21,792,435 R275Q possibly damaging Het
Senp2 A G 16: 22,038,636 T403A possibly damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Skap2 T A 6: 52,003,669 I52L probably benign Het
Slc5a7 T C 17: 54,277,140 D374G possibly damaging Het
Slmap A T 14: 26,426,608 L699M possibly damaging Het
Sntg1 A C 1: 8,595,482 C203G possibly damaging Het
Stard9 T C 2: 120,703,113 S3284P probably benign Het
Tbx21 T C 11: 97,115,031 Y36C probably damaging Het
Tecpr2 A G 12: 110,939,877 Y971C probably damaging Het
Trpm5 T A 7: 143,087,763 I137F possibly damaging Het
Ttc30a2 A T 2: 75,977,714 N151K probably benign Het
Unk A G 11: 116,054,406 K426E probably damaging Het
Zc3hc1 T C 6: 30,375,982 D193G probably benign Het
Other mutations in Epha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Epha1 APN 6 42360551 missense probably damaging 1.00
IGL02388:Epha1 APN 6 42365016 missense probably damaging 1.00
IGL02614:Epha1 APN 6 42360557 missense probably benign 0.02
IGL03019:Epha1 APN 6 42362752 missense probably damaging 1.00
buddy UTSW 6 42361451 missense probably damaging 1.00
R0369:Epha1 UTSW 6 42365473 missense probably damaging 1.00
R0894:Epha1 UTSW 6 42363822 missense probably benign 0.45
R1353:Epha1 UTSW 6 42361837 missense probably damaging 0.99
R1451:Epha1 UTSW 6 42361451 missense probably damaging 1.00
R1840:Epha1 UTSW 6 42363588 missense probably damaging 0.99
R2064:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2065:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2067:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2087:Epha1 UTSW 6 42363568 missense probably benign 0.01
R3691:Epha1 UTSW 6 42361130 missense probably damaging 1.00
R3952:Epha1 UTSW 6 42364285 missense probably damaging 0.99
R4111:Epha1 UTSW 6 42358838 missense possibly damaging 0.88
R4280:Epha1 UTSW 6 42365052 missense probably damaging 1.00
R4369:Epha1 UTSW 6 42365457 missense probably damaging 1.00
R4371:Epha1 UTSW 6 42365457 missense probably damaging 1.00
R4491:Epha1 UTSW 6 42360666 missense probably damaging 1.00
R4743:Epha1 UTSW 6 42372221 missense probably benign 0.00
R4838:Epha1 UTSW 6 42363816 missense probably benign 0.04
R4857:Epha1 UTSW 6 42361482 missense probably benign 0.00
R4884:Epha1 UTSW 6 42360734 missense probably damaging 0.99
R4929:Epha1 UTSW 6 42364599 missense probably benign 0.05
R5239:Epha1 UTSW 6 42365010 missense possibly damaging 0.87
R5416:Epha1 UTSW 6 42365871 missense probably damaging 1.00
R5595:Epha1 UTSW 6 42364634 missense possibly damaging 0.78
R5838:Epha1 UTSW 6 42361646 missense probably damaging 1.00
R6395:Epha1 UTSW 6 42366172 missense probably damaging 1.00
R6594:Epha1 UTSW 6 42364691 missense probably benign
R6639:Epha1 UTSW 6 42365935 nonsense probably null
R7092:Epha1 UTSW 6 42364245 missense probably benign 0.36
R7569:Epha1 UTSW 6 42365422 missense possibly damaging 0.70
R7705:Epha1 UTSW 6 42362668 missense probably damaging 0.99
R7802:Epha1 UTSW 6 42361941 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CACACTCAGACCCAGGTTTC -3'
(R):5'- CTAGCCATGGAAGACAGTACTGG -3'

Sequencing Primer
(F):5'- TCAGACCCAGGTTTCCTCGG -3'
(R):5'- CAGTACTGGTTAGATTGCAGAGC -3'
Posted On2016-03-01