Incidental Mutation 'R4847:Ckap2'
ID373311
Institutional Source Beutler Lab
Gene Symbol Ckap2
Ensembl Gene ENSMUSG00000037725
Gene Namecytoskeleton associated protein 2
SynonymsLB1
MMRRC Submission 042460-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R4847 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22168160-22185819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22175068 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 460 (E460G)
Ref Sequence ENSEMBL: ENSMUSP00000039518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046916]
Predicted Effect probably damaging
Transcript: ENSMUST00000046916
AA Change: E460G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039518
Gene: ENSMUSG00000037725
AA Change: E460G

DomainStartEndE-ValueType
low complexity region 221 234 N/A INTRINSIC
Pfam:CKAP2_C 315 651 3.9e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211629
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeleton-associated protein that stabalizes microtubules and plays a role in the regulation of cell division. The encoded protein is itself regulated through phosphorylation at multiple serine and threonine residues. There is a pseudogene of this gene on chromosome 14. Alternative splicing results in multiple transcript variations. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik C T 11: 80,374,114 V171M probably damaging Het
Abhd3 A G 18: 10,647,786 S328P possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aldh1b1 G T 4: 45,802,625 K54N possibly damaging Het
Amacr C T 15: 10,994,872 Q257* probably null Het
Ankrd12 A T 17: 66,024,092 D309E probably benign Het
Anks6 T C 4: 47,033,266 T600A probably benign Het
Ap3b1 A G 13: 94,471,779 E586G probably benign Het
Atad2b A G 12: 4,944,901 probably null Het
Cant1 G A 11: 118,410,110 Q240* probably null Het
Casc1 T A 6: 145,175,185 H636L probably damaging Het
Cep152 T C 2: 125,618,474 Y186C possibly damaging Het
Cep76 C A 18: 67,619,569 R603I probably benign Het
Chad T C 11: 94,568,327 S352P probably benign Het
Col22a1 T C 15: 71,799,499 Y1004C unknown Het
Col9a3 G A 2: 180,615,525 G480S probably damaging Het
Cpsf2 A G 12: 101,997,302 D430G probably benign Het
Cramp1l T C 17: 24,985,089 D305G probably damaging Het
Ctnnd1 C A 2: 84,622,052 E76* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c39 A T 19: 39,560,896 N286I probably damaging Het
Ddx11 A G 17: 66,130,801 E174G probably damaging Het
Ddx19a T C 8: 110,977,045 E369G probably damaging Het
Epha1 T A 6: 42,361,914 D687V possibly damaging Het
Fgr T C 4: 132,994,648 W132R probably damaging Het
Fras1 A T 5: 96,544,992 D170V possibly damaging Het
Gas2l1 A G 11: 5,064,173 S96P probably damaging Het
Gfy G A 7: 45,177,596 P359S probably damaging Het
Hexim2 A G 11: 103,138,941 N273S probably benign Het
Hr A T 14: 70,556,476 T59S probably benign Het
Impdh2 A G 9: 108,564,671 Y166C probably damaging Het
Impdh2 T A 9: 108,565,515 F514Y probably benign Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Klhl17 A T 4: 156,231,597 H433Q probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kntc1 A C 5: 123,802,274 N1645T probably benign Het
Mcm8 A G 2: 132,820,003 I114V probably benign Het
Mink1 T A 11: 70,602,028 L160Q probably damaging Het
Mipol1 A T 12: 57,303,496 S27C probably damaging Het
Mthfr T C 4: 148,048,139 V217A probably damaging Het
Olfr1458 A G 19: 13,102,534 Y257H probably damaging Het
Olfr473 T A 7: 107,933,827 C102* probably null Het
Pde1c T C 6: 56,123,034 K614E possibly damaging Het
Pds5b A T 5: 150,748,112 E407V probably damaging Het
Pdzph1 A G 17: 58,973,530 S586P possibly damaging Het
Prkcb C T 7: 122,568,149 R361W probably benign Het
Psen2 T A 1: 180,245,632 probably null Het
Ptk2 T A 15: 73,231,956 M82L probably benign Het
Ptk2b T C 14: 66,173,882 D400G probably damaging Het
Samd8 G A 14: 21,792,435 R275Q possibly damaging Het
Senp2 A G 16: 22,038,636 T403A possibly damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Skap2 T A 6: 52,003,669 I52L probably benign Het
Slc5a7 T C 17: 54,277,140 D374G possibly damaging Het
Slmap A T 14: 26,426,608 L699M possibly damaging Het
Sntg1 A C 1: 8,595,482 C203G possibly damaging Het
Stard9 T C 2: 120,703,113 S3284P probably benign Het
Tbx21 T C 11: 97,115,031 Y36C probably damaging Het
Tecpr2 A G 12: 110,939,877 Y971C probably damaging Het
Trpm5 T A 7: 143,087,763 I137F possibly damaging Het
Ttc30a2 A T 2: 75,977,714 N151K probably benign Het
Unk A G 11: 116,054,406 K426E probably damaging Het
Zc3hc1 T C 6: 30,375,982 D193G probably benign Het
Other mutations in Ckap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Ckap2 APN 8 22169758 missense probably damaging 1.00
IGL01519:Ckap2 APN 8 22168898 missense probably benign 0.00
R0530:Ckap2 UTSW 8 22175972 splice site probably benign
R1638:Ckap2 UTSW 8 22175796 missense possibly damaging 0.84
R1965:Ckap2 UTSW 8 22175787 missense possibly damaging 0.95
R2047:Ckap2 UTSW 8 22168747 missense probably benign 0.03
R3023:Ckap2 UTSW 8 22175861 missense possibly damaging 0.95
R3843:Ckap2 UTSW 8 22175758 missense probably damaging 0.98
R4587:Ckap2 UTSW 8 22176976 missense probably benign
R4754:Ckap2 UTSW 8 22168895 missense possibly damaging 0.93
R5354:Ckap2 UTSW 8 22177565 missense probably damaging 0.96
R5423:Ckap2 UTSW 8 22177196 missense probably benign 0.33
R5717:Ckap2 UTSW 8 22175047 missense probably damaging 0.98
R6518:Ckap2 UTSW 8 22173303 missense probably benign 0.41
R7088:Ckap2 UTSW 8 22169866 missense possibly damaging 0.59
R7466:Ckap2 UTSW 8 22177386 missense probably benign 0.02
R7943:Ckap2 UTSW 8 22175074 missense probably damaging 0.97
X0058:Ckap2 UTSW 8 22176798 missense probably benign
Z1176:Ckap2 UTSW 8 22169794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCTTGCAGCCTTCACTG -3'
(R):5'- CTGCTGAGTCATGTTTCCAGATC -3'

Sequencing Primer
(F):5'- GAACTCCACCAAGTCCTCTTGTTTC -3'
(R):5'- ATGTTTCCAGATCCTTCTGTCAG -3'
Posted On2016-03-01