Incidental Mutation 'R4847:Mipol1'
ID 373326
Institutional Source Beutler Lab
Gene Symbol Mipol1
Ensembl Gene ENSMUSG00000047022
Gene Name mirror-image polydactyly 1
Synonyms 1700081O04Rik, 6030439O22Rik, D12Ertd19e
MMRRC Submission 042460-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4847 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 57230427-57497199 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57303496 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 27 (S27C)
Ref Sequence ENSEMBL: ENSMUSP00000117005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000123498
AA Change: S27C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: S27C

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000130447
AA Change: S27C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: S27C

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136006
Predicted Effect probably damaging
Transcript: ENSMUST00000145003
AA Change: S27C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022
AA Change: S27C

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150292
Predicted Effect probably damaging
Transcript: ENSMUST00000153137
AA Change: S27C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: S27C

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153755
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik C T 11: 80,374,114 V171M probably damaging Het
Abhd3 A G 18: 10,647,786 S328P possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aldh1b1 G T 4: 45,802,625 K54N possibly damaging Het
Amacr C T 15: 10,994,872 Q257* probably null Het
Ankrd12 A T 17: 66,024,092 D309E probably benign Het
Anks6 T C 4: 47,033,266 T600A probably benign Het
Ap3b1 A G 13: 94,471,779 E586G probably benign Het
Atad2b A G 12: 4,944,901 probably null Het
Cant1 G A 11: 118,410,110 Q240* probably null Het
Casc1 T A 6: 145,175,185 H636L probably damaging Het
Cep152 T C 2: 125,618,474 Y186C possibly damaging Het
Cep76 C A 18: 67,619,569 R603I probably benign Het
Chad T C 11: 94,568,327 S352P probably benign Het
Ckap2 T C 8: 22,175,068 E460G probably damaging Het
Col22a1 T C 15: 71,799,499 Y1004C unknown Het
Col9a3 G A 2: 180,615,525 G480S probably damaging Het
Cpsf2 A G 12: 101,997,302 D430G probably benign Het
Cramp1l T C 17: 24,985,089 D305G probably damaging Het
Ctnnd1 C A 2: 84,622,052 E76* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c39 A T 19: 39,560,896 N286I probably damaging Het
Ddx11 A G 17: 66,130,801 E174G probably damaging Het
Ddx19a T C 8: 110,977,045 E369G probably damaging Het
Epha1 T A 6: 42,361,914 D687V possibly damaging Het
Fgr T C 4: 132,994,648 W132R probably damaging Het
Fras1 A T 5: 96,544,992 D170V possibly damaging Het
Gas2l1 A G 11: 5,064,173 S96P probably damaging Het
Gfy G A 7: 45,177,596 P359S probably damaging Het
Hexim2 A G 11: 103,138,941 N273S probably benign Het
Hr A T 14: 70,556,476 T59S probably benign Het
Impdh2 A G 9: 108,564,671 Y166C probably damaging Het
Impdh2 T A 9: 108,565,515 F514Y probably benign Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Klhl17 A T 4: 156,231,597 H433Q probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kntc1 A C 5: 123,802,274 N1645T probably benign Het
Mcm8 A G 2: 132,820,003 I114V probably benign Het
Mink1 T A 11: 70,602,028 L160Q probably damaging Het
Mthfr T C 4: 148,048,139 V217A probably damaging Het
Olfr1458 A G 19: 13,102,534 Y257H probably damaging Het
Olfr473 T A 7: 107,933,827 C102* probably null Het
Pde1c T C 6: 56,123,034 K614E possibly damaging Het
Pds5b A T 5: 150,748,112 E407V probably damaging Het
Pdzph1 A G 17: 58,973,530 S586P possibly damaging Het
Prkcb C T 7: 122,568,149 R361W probably benign Het
Psen2 T A 1: 180,245,632 probably null Het
Ptk2 T A 15: 73,231,956 M82L probably benign Het
Ptk2b T C 14: 66,173,882 D400G probably damaging Het
Samd8 G A 14: 21,792,435 R275Q possibly damaging Het
Senp2 A G 16: 22,038,636 T403A possibly damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Skap2 T A 6: 52,003,669 I52L probably benign Het
Slc5a7 T C 17: 54,277,140 D374G possibly damaging Het
Slmap A T 14: 26,426,608 L699M possibly damaging Het
Sntg1 A C 1: 8,595,482 C203G possibly damaging Het
Stard9 T C 2: 120,703,113 S3284P probably benign Het
Tbx21 T C 11: 97,115,031 Y36C probably damaging Het
Tecpr2 A G 12: 110,939,877 Y971C probably damaging Het
Trpm5 T A 7: 143,087,763 I137F possibly damaging Het
Ttc30a2 A T 2: 75,977,714 N151K probably benign Het
Unk A G 11: 116,054,406 K426E probably damaging Het
Zc3hc1 T C 6: 30,375,982 D193G probably benign Het
Other mutations in Mipol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mipol1 APN 12 57307353 splice site probably benign
IGL01139:Mipol1 APN 12 57306035 nonsense probably null
IGL02679:Mipol1 APN 12 57306043 missense possibly damaging 0.84
IGL03109:Mipol1 APN 12 57364224 missense probably benign 0.20
R0001:Mipol1 UTSW 12 57460839 splice site probably benign
R0220:Mipol1 UTSW 12 57457150 missense probably damaging 1.00
R0271:Mipol1 UTSW 12 57460954 unclassified probably benign
R0284:Mipol1 UTSW 12 57457069 missense probably damaging 0.98
R0496:Mipol1 UTSW 12 57457177 missense probably damaging 0.99
R0538:Mipol1 UTSW 12 57414411 critical splice donor site probably null
R1082:Mipol1 UTSW 12 57325616 missense probably damaging 0.98
R1552:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R1558:Mipol1 UTSW 12 57332341 missense probably damaging 1.00
R1928:Mipol1 UTSW 12 57332419 missense probably damaging 1.00
R2104:Mipol1 UTSW 12 57306056 splice site probably null
R2495:Mipol1 UTSW 12 57460990 splice site probably benign
R3723:Mipol1 UTSW 12 57457092 missense probably damaging 1.00
R4431:Mipol1 UTSW 12 57303524 missense possibly damaging 0.58
R4447:Mipol1 UTSW 12 57352748 intron probably benign
R4654:Mipol1 UTSW 12 57306132 missense probably benign 0.22
R4851:Mipol1 UTSW 12 57332301 missense probably damaging 1.00
R5113:Mipol1 UTSW 12 57496499 missense probably benign 0.36
R5668:Mipol1 UTSW 12 57325560 missense possibly damaging 0.48
R6535:Mipol1 UTSW 12 57306100 missense possibly damaging 0.95
R7172:Mipol1 UTSW 12 57325535 missense possibly damaging 0.95
R7191:Mipol1 UTSW 12 57457066 missense probably benign 0.01
R7560:Mipol1 UTSW 12 57306073 missense possibly damaging 0.94
R8508:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R8752:Mipol1 UTSW 12 57325581 missense probably damaging 1.00
R8772:Mipol1 UTSW 12 57325632 missense probably benign 0.23
R8861:Mipol1 UTSW 12 57306016 missense probably benign 0.00
R8928:Mipol1 UTSW 12 57460865 missense probably benign 0.00
R9011:Mipol1 UTSW 12 57457079 missense probably benign 0.03
R9250:Mipol1 UTSW 12 57414383 missense probably damaging 1.00
R9383:Mipol1 UTSW 12 57306034 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACTCAACAATTTTCCTATGTGGC -3'
(R):5'- GAAATTGTTTCCAAGTCACTAGCAC -3'

Sequencing Primer
(F):5'- AACAATTTTCCTATGTGGCTATGTCC -3'
(R):5'- TAGCACATTAAATTTATCCGACACC -3'
Posted On 2016-03-01