Mutagenetix > Incidental Mutations

Incidental Mutation 'R4847:Mipol1'

373326

Institutional Source

Beutler Lab

Gene Symbol

Mipol1

Ensembl Gene

ENSMUSG00000047022

Gene Name

mirror-image polydactyly 1

Synonyms

1700081O04Rik, 6030439O22Rik, D12Ertd19e

MMRRC Submission

042460-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4847 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57230427-57497199 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 57303496 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 27 (S27C)

Ref Sequence

ENSEMBL: ENSMUSP00000117005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000123498
AA Change: S27C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: S27C

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000130447
AA Change: S27C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: S27C

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136006

Predicted Effect

probably damaging
Transcript: ENSMUST00000145003
AA Change: S27C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022
AA Change: S27C

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150292

Predicted Effect

probably damaging
Transcript: ENSMUST00000153137
AA Change: S27C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: S27C

Domain	Start	End	E-Value	Type
coiled coil region	70	127	N/A	INTRINSIC
Blast:HNHc	220	265	2e-15	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153439

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730455P16Rik	C	T	11: 80,374,114	V171M	probably damaging	Het
Abhd3	A	G	18: 10,647,786	S328P	possibly damaging	Het
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Aldh1b1	G	T	4: 45,802,625	K54N	possibly damaging	Het
Amacr	C	T	15: 10,994,872	Q257*	probably null	Het
Ankrd12	A	T	17: 66,024,092	D309E	probably benign	Het
Anks6	T	C	4: 47,033,266	T600A	probably benign	Het
Ap3b1	A	G	13: 94,471,779	E586G	probably benign	Het
Atad2b	A	G	12: 4,944,901		probably null	Het
Cant1	G	A	11: 118,410,110	Q240*	probably null	Het
Casc1	T	A	6: 145,175,185	H636L	probably damaging	Het
Cep152	T	C	2: 125,618,474	Y186C	possibly damaging	Het
Cep76	C	A	18: 67,619,569	R603I	probably benign	Het
Chad	T	C	11: 94,568,327	S352P	probably benign	Het
Ckap2	T	C	8: 22,175,068	E460G	probably damaging	Het
Col22a1	T	C	15: 71,799,499	Y1004C	unknown	Het
Col9a3	G	A	2: 180,615,525	G480S	probably damaging	Het
Cpsf2	A	G	12: 101,997,302	D430G	probably benign	Het
Cramp1l	T	C	17: 24,985,089	D305G	probably damaging	Het
Ctnnd1	C	A	2: 84,622,052	E76*	probably null	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Cyp2c39	A	T	19: 39,560,896	N286I	probably damaging	Het
Ddx11	A	G	17: 66,130,801	E174G	probably damaging	Het
Ddx19a	T	C	8: 110,977,045	E369G	probably damaging	Het
Epha1	T	A	6: 42,361,914	D687V	possibly damaging	Het
Fgr	T	C	4: 132,994,648	W132R	probably damaging	Het
Fras1	A	T	5: 96,544,992	D170V	possibly damaging	Het
Gas2l1	A	G	11: 5,064,173	S96P	probably damaging	Het
Gfy	G	A	7: 45,177,596	P359S	probably damaging	Het
Hexim2	A	G	11: 103,138,941	N273S	probably benign	Het
Hr	A	T	14: 70,556,476	T59S	probably benign	Het
Impdh2	A	G	9: 108,564,671	Y166C	probably damaging	Het
Impdh2	T	A	9: 108,565,515	F514Y	probably benign	Het
Iqgap2	A	G	13: 95,673,743	F731S	probably benign	Het
Klhl17	A	T	4: 156,231,597	H433Q	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Kntc1	A	C	5: 123,802,274	N1645T	probably benign	Het
Mcm8	A	G	2: 132,820,003	I114V	probably benign	Het
Mink1	T	A	11: 70,602,028	L160Q	probably damaging	Het
Mthfr	T	C	4: 148,048,139	V217A	probably damaging	Het
Olfr1458	A	G	19: 13,102,534	Y257H	probably damaging	Het
Olfr473	T	A	7: 107,933,827	C102*	probably null	Het
Pde1c	T	C	6: 56,123,034	K614E	possibly damaging	Het
Pds5b	A	T	5: 150,748,112	E407V	probably damaging	Het
Pdzph1	A	G	17: 58,973,530	S586P	possibly damaging	Het
Prkcb	C	T	7: 122,568,149	R361W	probably benign	Het
Psen2	T	A	1: 180,245,632		probably null	Het
Ptk2	T	A	15: 73,231,956	M82L	probably benign	Het
Ptk2b	T	C	14: 66,173,882	D400G	probably damaging	Het
Samd8	G	A	14: 21,792,435	R275Q	possibly damaging	Het
Senp2	A	G	16: 22,038,636	T403A	possibly damaging	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Skap2	T	A	6: 52,003,669	I52L	probably benign	Het
Slc5a7	T	C	17: 54,277,140	D374G	possibly damaging	Het
Slmap	A	T	14: 26,426,608	L699M	possibly damaging	Het
Sntg1	A	C	1: 8,595,482	C203G	possibly damaging	Het
Stard9	T	C	2: 120,703,113	S3284P	probably benign	Het
Tbx21	T	C	11: 97,115,031	Y36C	probably damaging	Het
Tecpr2	A	G	12: 110,939,877	Y971C	probably damaging	Het
Trpm5	T	A	7: 143,087,763	I137F	possibly damaging	Het
Ttc30a2	A	T	2: 75,977,714	N151K	probably benign	Het
Unk	A	G	11: 116,054,406	K426E	probably damaging	Het
Zc3hc1	T	C	6: 30,375,982	D193G	probably benign	Het

Other mutations in Mipol1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00719:Mipol1	APN	12	57307353	splice site	probably benign
IGL01139:Mipol1	APN	12	57306035	nonsense	probably null
IGL02679:Mipol1	APN	12	57306043	missense	possibly damaging	0.84
IGL03109:Mipol1	APN	12	57364224	missense	probably benign	0.20
R0001:Mipol1	UTSW	12	57460839	splice site	probably benign
R0220:Mipol1	UTSW	12	57457150	missense	probably damaging	1.00
R0271:Mipol1	UTSW	12	57460954	unclassified	probably benign
R0284:Mipol1	UTSW	12	57457069	missense	probably damaging	0.98
R0496:Mipol1	UTSW	12	57457177	missense	probably damaging	0.99
R0538:Mipol1	UTSW	12	57414411	critical splice donor site	probably null
R1082:Mipol1	UTSW	12	57325616	missense	probably damaging	0.98
R1552:Mipol1	UTSW	12	57306088	missense	possibly damaging	0.86
R1558:Mipol1	UTSW	12	57332341	missense	probably damaging	1.00
R1928:Mipol1	UTSW	12	57332419	missense	probably damaging	1.00
R2104:Mipol1	UTSW	12	57306056	splice site	probably null
R2495:Mipol1	UTSW	12	57460990	splice site	probably benign
R3723:Mipol1	UTSW	12	57457092	missense	probably damaging	1.00
R4431:Mipol1	UTSW	12	57303524	missense	possibly damaging	0.58
R4447:Mipol1	UTSW	12	57352748	intron	probably benign
R4654:Mipol1	UTSW	12	57306132	missense	probably benign	0.22
R4851:Mipol1	UTSW	12	57332301	missense	probably damaging	1.00
R5113:Mipol1	UTSW	12	57496499	missense	probably benign	0.36
R5668:Mipol1	UTSW	12	57325560	missense	possibly damaging	0.48
R6535:Mipol1	UTSW	12	57306100	missense	possibly damaging	0.95
R7172:Mipol1	UTSW	12	57325535	missense	possibly damaging	0.95
R7191:Mipol1	UTSW	12	57457066	missense	probably benign	0.01
R7560:Mipol1	UTSW	12	57306073	missense	possibly damaging	0.94
R8508:Mipol1	UTSW	12	57306088	missense	possibly damaging	0.86
R8752:Mipol1	UTSW	12	57325581	missense	probably damaging	1.00
R8772:Mipol1	UTSW	12	57325632	missense	probably benign	0.23
R8861:Mipol1	UTSW	12	57306016	missense	probably benign	0.00
R8928:Mipol1	UTSW	12	57460865	missense	probably benign	0.00
R9011:Mipol1	UTSW	12	57457079	missense	probably benign	0.03
R9250:Mipol1	UTSW	12	57414383	missense	probably damaging	1.00
R9383:Mipol1	UTSW	12	57306034	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGACTCAACAATTTTCCTATGTGGC -3'
(R):5'- GAAATTGTTTCCAAGTCACTAGCAC -3'

Sequencing Primer
(F):5'- AACAATTTTCCTATGTGGCTATGTCC -3'
(R):5'- TAGCACATTAAATTTATCCGACACC -3'

Posted On

2016-03-01