Incidental Mutation 'R4847:Pdzph1'
ID 373344
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission 042460-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R4847 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59280525 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 586 (S586P)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect possibly damaging
Transcript: ENSMUST00000025064
AA Change: S586P

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: S586P

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik C T 11: 80,264,940 (GRCm39) V171M probably damaging Het
Abhd3 A G 18: 10,647,786 (GRCm39) S328P possibly damaging Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Aldh1b1 G T 4: 45,802,625 (GRCm39) K54N possibly damaging Het
Amacr C T 15: 10,994,958 (GRCm39) Q257* probably null Het
Ankrd12 A T 17: 66,331,087 (GRCm39) D309E probably benign Het
Anks6 T C 4: 47,033,266 (GRCm39) T600A probably benign Het
Ap3b1 A G 13: 94,608,287 (GRCm39) E586G probably benign Het
Atad2b A G 12: 4,994,901 (GRCm39) probably null Het
Cant1 G A 11: 118,300,936 (GRCm39) Q240* probably null Het
Cep152 T C 2: 125,460,394 (GRCm39) Y186C possibly damaging Het
Cep76 C A 18: 67,752,639 (GRCm39) R603I probably benign Het
Chad T C 11: 94,459,153 (GRCm39) S352P probably benign Het
Ckap2 T C 8: 22,665,084 (GRCm39) E460G probably damaging Het
Col22a1 T C 15: 71,671,348 (GRCm39) Y1004C unknown Het
Col9a3 G A 2: 180,257,318 (GRCm39) G480S probably damaging Het
Cpsf2 A G 12: 101,963,561 (GRCm39) D430G probably benign Het
Cramp1 T C 17: 25,204,063 (GRCm39) D305G probably damaging Het
Ctnnd1 C A 2: 84,452,396 (GRCm39) E76* probably null Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Cyp2c39 A T 19: 39,549,340 (GRCm39) N286I probably damaging Het
Ddx11 A G 17: 66,437,796 (GRCm39) E174G probably damaging Het
Ddx19a T C 8: 111,703,677 (GRCm39) E369G probably damaging Het
Dnai7 T A 6: 145,120,911 (GRCm39) H636L probably damaging Het
Epha1 T A 6: 42,338,848 (GRCm39) D687V possibly damaging Het
Fgr T C 4: 132,721,959 (GRCm39) W132R probably damaging Het
Fras1 A T 5: 96,692,851 (GRCm39) D170V possibly damaging Het
Gas2l1 A G 11: 5,014,173 (GRCm39) S96P probably damaging Het
Gfy G A 7: 44,827,020 (GRCm39) P359S probably damaging Het
Hexim2 A G 11: 103,029,767 (GRCm39) N273S probably benign Het
Hr A T 14: 70,793,916 (GRCm39) T59S probably benign Het
Ift70a2 A T 2: 75,808,058 (GRCm39) N151K probably benign Het
Impdh2 A G 9: 108,441,870 (GRCm39) Y166C probably damaging Het
Impdh2 T A 9: 108,442,714 (GRCm39) F514Y probably benign Het
Iqgap2 A G 13: 95,810,251 (GRCm39) F731S probably benign Het
Klhl17 A T 4: 156,316,054 (GRCm39) H433Q probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Kntc1 A C 5: 123,940,337 (GRCm39) N1645T probably benign Het
Mcm8 A G 2: 132,661,923 (GRCm39) I114V probably benign Het
Mink1 T A 11: 70,492,854 (GRCm39) L160Q probably damaging Het
Mipol1 A T 12: 57,350,282 (GRCm39) S27C probably damaging Het
Mthfr T C 4: 148,132,596 (GRCm39) V217A probably damaging Het
Or5b105 A G 19: 13,079,898 (GRCm39) Y257H probably damaging Het
Or5p53 T A 7: 107,533,034 (GRCm39) C102* probably null Het
Pde1c T C 6: 56,100,019 (GRCm39) K614E possibly damaging Het
Pds5b A T 5: 150,671,577 (GRCm39) E407V probably damaging Het
Prkcb C T 7: 122,167,372 (GRCm39) R361W probably benign Het
Psen2 T A 1: 180,073,197 (GRCm39) probably null Het
Ptk2 T A 15: 73,103,805 (GRCm39) M82L probably benign Het
Ptk2b T C 14: 66,411,331 (GRCm39) D400G probably damaging Het
Samd8 G A 14: 21,842,503 (GRCm39) R275Q possibly damaging Het
Senp2 A G 16: 21,857,386 (GRCm39) T403A possibly damaging Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Skap2 T A 6: 51,980,649 (GRCm39) I52L probably benign Het
Slc5a7 T C 17: 54,584,168 (GRCm39) D374G possibly damaging Het
Slmap A T 14: 26,147,763 (GRCm39) L699M possibly damaging Het
Sntg1 A C 1: 8,665,706 (GRCm39) C203G possibly damaging Het
Stard9 T C 2: 120,533,594 (GRCm39) S3284P probably benign Het
Tbx21 T C 11: 97,005,857 (GRCm39) Y36C probably damaging Het
Tecpr2 A G 12: 110,906,311 (GRCm39) Y971C probably damaging Het
Trpm5 T A 7: 142,641,500 (GRCm39) I137F possibly damaging Het
Unk A G 11: 115,945,232 (GRCm39) K426E probably damaging Het
Zc3hc1 T C 6: 30,375,981 (GRCm39) D193G probably benign Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGCTGGTCGACTCTCTAGGG -3'
(R):5'- AGACTACTGGGAACACATTTTCC -3'

Sequencing Primer
(F):5'- ACTCTCTAGGGTTTCTTATTGCCATG -3'
(R):5'- ACTGGGAACACATTTTCCTTTAGTC -3'
Posted On 2016-03-01