Incidental Mutation 'R4849:Angptl1'
ID373357
Institutional Source Beutler Lab
Gene Symbol Angptl1
Ensembl Gene ENSMUSG00000033544
Gene Nameangiopoietin-like 1
SynonymsANGPT3, ANG-3, ANG3, 2810039D03Rik, ANGY, ARP1, ANG3
MMRRC Submission 042461-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4849 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156838562-156861078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 156857165 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 301 (N301K)
Ref Sequence ENSEMBL: ENSMUSP00000027885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027885] [ENSMUST00000027886] [ENSMUST00000063199] [ENSMUST00000171292] [ENSMUST00000172057] [ENSMUST00000185198] [ENSMUST00000188656] [ENSMUST00000189316] [ENSMUST00000190648] [ENSMUST00000191605] [ENSMUST00000192343]
Predicted Effect probably benign
Transcript: ENSMUST00000027885
AA Change: N301K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027885
Gene: ENSMUSG00000033544
AA Change: N301K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FBG 274 489 1.3e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000027886
SMART Domains Protein: ENSMUSP00000027886
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 439 552 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063199
SMART Domains Protein: ENSMUSP00000063872
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171292
SMART Domains Protein: ENSMUSP00000130581
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172057
SMART Domains Protein: ENSMUSP00000132533
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
RasGEF 5 253 1.35e-83 SMART
low complexity region 359 382 N/A INTRINSIC
PH 430 543 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185198
SMART Domains Protein: ENSMUSP00000139618
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
Blast:PH 465 562 3e-55 BLAST
PDB:2DTC|B 466 551 9e-34 PDB
SCOP:d1btn__ 467 546 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188656
SMART Domains Protein: ENSMUSP00000140342
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189316
SMART Domains Protein: ENSMUSP00000140230
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PDB:2DTC|B 466 520 6e-16 PDB
SCOP:d1btn__ 467 519 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190648
SMART Domains Protein: ENSMUSP00000140055
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191605
SMART Domains Protein: ENSMUSP00000139645
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192343
SMART Domains Protein: ENSMUSP00000142004
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
SCOP:d1bkds_ 1 70 3e-5 SMART
PDB:3QXL|B 38 71 3e-14 PDB
Blast:RasGEF 45 74 1e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194998
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. The protein encoded by this gene is another member of the angiopoietin family that is widely expressed in adult tissues with mRNA levels highest in highly vascularized tissues. This protein was found to be a secretory protein that does not act as an endothelial cell mitogen in vitro. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no detectable phenotypic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G T 7: 28,615,452 R239S possibly damaging Het
Ankrd26 T A 6: 118,532,296 T603S probably benign Het
App T C 16: 85,056,434 D252G unknown Het
Atxn3 A G 12: 101,934,368 S219P probably benign Het
Birc6 T C 17: 74,647,388 S3397P probably damaging Het
Bivm A G 1: 44,142,873 I414V possibly damaging Het
Cemip A G 7: 83,935,737 F1324L possibly damaging Het
Ckap5 T A 2: 91,615,271 N1724K probably damaging Het
Corin T A 5: 72,302,835 M1035L probably damaging Het
Ctnna3 T C 10: 64,873,315 I711T probably damaging Het
Cts6 A T 13: 61,201,601 W98R probably null Het
Dip2a A G 10: 76,294,533 S580P probably damaging Het
Dock6 A G 9: 21,811,772 probably null Het
Dusp15 T A 2: 152,949,082 T32S probably damaging Het
Eogt T A 6: 97,116,055 N387I probably damaging Het
Evx2 T C 2: 74,659,331 D29G probably benign Het
Fat1 A G 8: 45,012,970 N1422S probably benign Het
Fat2 T C 11: 55,310,637 D537G probably damaging Het
Fat3 A C 9: 16,377,948 I93S probably benign Het
Fem1b T C 9: 62,797,294 E228G probably damaging Het
Fh1 A G 1: 175,620,506 T25A probably benign Het
Fndc3b A G 3: 27,459,948 W695R probably damaging Het
Gaa G A 11: 119,272,987 V222I possibly damaging Het
Ggnbp1 T C 17: 27,032,973 probably null Het
Gipc1 A G 8: 83,662,127 Y154C probably benign Het
Gm5356 G T 8: 89,187,042 noncoding transcript Het
Gnl1 T A 17: 35,987,711 probably null Het
Gpcpd1 C T 2: 132,534,099 G605R probably damaging Het
Guca1a T C 17: 47,394,737 T177A possibly damaging Het
Ifit1bl1 T C 19: 34,594,676 E127G probably damaging Het
Ift81 A T 5: 122,591,219 I350N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A G 6: 125,043,983 R23G probably damaging Het
Ins1 A G 19: 52,264,946 N108S probably damaging Het
Iqce A T 5: 140,693,459 M72K possibly damaging Het
Itga3 C A 11: 95,076,271 M22I probably benign Het
Kctd18 T C 1: 57,961,993 E201G probably damaging Het
Klc1 A G 12: 111,781,695 N344S probably damaging Het
Klrb1f A T 6: 129,056,384 I192F probably damaging Het
Klrg2 A T 6: 38,630,279 probably null Het
Kntc1 A C 5: 123,759,065 I164L probably benign Het
Ltf T A 9: 111,025,990 I357K probably benign Het
Mr1 T C 1: 155,130,690 T304A probably benign Het
Msh6 C T 17: 87,983,519 R178C possibly damaging Het
Mtch1 T C 17: 29,347,591 D66G probably benign Het
Mtmr7 A G 8: 40,608,997 V15A probably benign Het
Mtss1l A T 8: 110,726,243 H40L possibly damaging Het
Mxra8 A G 4: 155,840,874 probably benign Het
Myo3b T C 2: 70,244,909 L535P probably damaging Het
Neurl2 T A 2: 164,832,819 probably null Het
Nfia A C 4: 98,081,811 T503P probably damaging Het
Noa1 T C 5: 77,306,332 E487G possibly damaging Het
Nuak1 A T 10: 84,375,279 V315D probably damaging Het
Nup205 A G 6: 35,230,570 N1519S possibly damaging Het
Olfr107 T C 17: 37,405,698 V50A probably benign Het
Olfr364-ps1 T C 2: 37,146,254 L14P probably damaging Het
Olfr417 T A 1: 174,369,400 I161K probably damaging Het
Olfr466 G A 13: 65,152,679 V152M possibly damaging Het
Olfr524 G T 7: 140,202,427 C114* probably null Het
Olfr585 A G 7: 103,098,319 I193V possibly damaging Het
Peli1 T A 11: 21,148,528 probably benign Het
Ppp6r1 A G 7: 4,643,207 L175P probably damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Prss30 T A 17: 23,972,795 I251F probably benign Het
Psme3 A T 11: 101,317,081 N21Y probably benign Het
Ptpra T C 2: 130,532,161 Y271H probably damaging Het
Ralgapa1 T A 12: 55,698,803 N1303Y probably damaging Het
Rims4 T C 2: 163,865,543 I121V probably benign Het
Rnf123 A T 9: 108,056,091 L1149Q probably damaging Het
Ryr3 T A 2: 112,908,462 L593F probably damaging Het
Sec23b T C 2: 144,585,599 F582S probably damaging Het
Sgpl1 T C 10: 61,104,518 K335R probably benign Het
Sirpa C T 2: 129,609,243 T141I probably damaging Het
Slit1 G T 19: 41,649,544 A270E probably benign Het
Snap91 T C 9: 86,792,560 T533A possibly damaging Het
Sphkap T G 1: 83,277,384 E881D probably benign Het
Sptan1 C A 2: 30,011,042 R1407S probably damaging Het
Tfdp1 A G 8: 13,373,895 T353A probably benign Het
Ttyh1 A G 7: 4,122,534 I62V possibly damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp398 T C 6: 47,859,512 I82T possibly damaging Het
Zp1 A G 19: 10,918,834 Y176H possibly damaging Het
Other mutations in Angptl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02835:Angptl1 UTSW 1 156858520 missense probably benign 0.22
R0285:Angptl1 UTSW 1 156845215 missense probably benign 0.00
R1237:Angptl1 UTSW 1 156858584 missense probably damaging 1.00
R1573:Angptl1 UTSW 1 156857170 missense possibly damaging 0.81
R1722:Angptl1 UTSW 1 156857085 missense possibly damaging 0.87
R4621:Angptl1 UTSW 1 156844924 missense probably damaging 1.00
R4795:Angptl1 UTSW 1 156860583 missense possibly damaging 0.88
R4915:Angptl1 UTSW 1 156844818 missense probably benign
R5919:Angptl1 UTSW 1 156858546 missense probably damaging 1.00
R6656:Angptl1 UTSW 1 156857236 missense probably damaging 1.00
R6833:Angptl1 UTSW 1 156844693 missense probably benign 0.04
R6834:Angptl1 UTSW 1 156844693 missense probably benign 0.04
R7453:Angptl1 UTSW 1 156844851 missense probably benign 0.06
R7657:Angptl1 UTSW 1 156857220 missense probably benign 0.01
R7692:Angptl1 UTSW 1 156845315 missense probably damaging 1.00
RF002:Angptl1 UTSW 1 156857224 missense possibly damaging 0.79
X0066:Angptl1 UTSW 1 156844935 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGAGTTGGCCTGATGTCAC -3'
(R):5'- ACTATTGGAAGGCCTGCTCAG -3'

Sequencing Primer
(F):5'- CACACAGCAGATAAAATGTGGTTATC -3'
(R):5'- GCTCAGGTCTACCTTCTCCAGG -3'
Posted On2016-03-01