Incidental Mutation 'R4849:Myo3b'
ID 373362
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 042461-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4849 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70075253 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 535 (L535P)
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: L563P

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: L563P

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112243
AA Change: L535P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: L535P

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.5967 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G T 7: 28,314,877 (GRCm39) R239S possibly damaging Het
Angptl1 C A 1: 156,684,735 (GRCm39) N301K probably benign Het
Ankrd26 T A 6: 118,509,257 (GRCm39) T603S probably benign Het
App T C 16: 84,853,322 (GRCm39) D252G unknown Het
Atxn3 A G 12: 101,900,627 (GRCm39) S219P probably benign Het
Birc6 T C 17: 74,954,383 (GRCm39) S3397P probably damaging Het
Bivm A G 1: 44,182,033 (GRCm39) I414V possibly damaging Het
Cemip A G 7: 83,584,945 (GRCm39) F1324L possibly damaging Het
Ckap5 T A 2: 91,445,616 (GRCm39) N1724K probably damaging Het
Corin T A 5: 72,460,178 (GRCm39) M1035L probably damaging Het
Ctnna3 T C 10: 64,709,094 (GRCm39) I711T probably damaging Het
Cts6 A T 13: 61,349,415 (GRCm39) W98R probably null Het
Dip2a A G 10: 76,130,367 (GRCm39) S580P probably damaging Het
Dock6 A G 9: 21,723,068 (GRCm39) probably null Het
Dusp15 T A 2: 152,791,002 (GRCm39) T32S probably damaging Het
Eogt T A 6: 97,093,016 (GRCm39) N387I probably damaging Het
Evx2 T C 2: 74,489,675 (GRCm39) D29G probably benign Het
Fat1 A G 8: 45,466,007 (GRCm39) N1422S probably benign Het
Fat2 T C 11: 55,201,463 (GRCm39) D537G probably damaging Het
Fat3 A C 9: 16,289,244 (GRCm39) I93S probably benign Het
Fem1b T C 9: 62,704,576 (GRCm39) E228G probably damaging Het
Fh1 A G 1: 175,448,072 (GRCm39) T25A probably benign Het
Fndc3b A G 3: 27,514,097 (GRCm39) W695R probably damaging Het
Gaa G A 11: 119,163,813 (GRCm39) V222I possibly damaging Het
Ggnbp1 T C 17: 27,251,947 (GRCm39) probably null Het
Gipc1 A G 8: 84,388,756 (GRCm39) Y154C probably benign Het
Gm5356 G T 8: 89,913,670 (GRCm39) noncoding transcript Het
Gnl1 T A 17: 36,298,603 (GRCm39) probably null Het
Gpcpd1 C T 2: 132,376,019 (GRCm39) G605R probably damaging Het
Guca1a T C 17: 47,705,662 (GRCm39) T177A possibly damaging Het
Ifit1bl1 T C 19: 34,572,076 (GRCm39) E127G probably damaging Het
Ift81 A T 5: 122,729,282 (GRCm39) I350N probably damaging Het
Ikbke GCC G 1: 131,203,004 (GRCm39) probably null Het
Ing4 A G 6: 125,020,946 (GRCm39) R23G probably damaging Het
Ins1 A G 19: 52,253,384 (GRCm39) N108S probably damaging Het
Iqce A T 5: 140,679,214 (GRCm39) M72K possibly damaging Het
Itga3 C A 11: 94,967,097 (GRCm39) M22I probably benign Het
Kctd18 T C 1: 58,001,152 (GRCm39) E201G probably damaging Het
Klc1 A G 12: 111,748,129 (GRCm39) N344S probably damaging Het
Klrb1f A T 6: 129,033,347 (GRCm39) I192F probably damaging Het
Klrg2 A T 6: 38,607,214 (GRCm39) probably null Het
Kntc1 A C 5: 123,897,128 (GRCm39) I164L probably benign Het
Ltf T A 9: 110,855,058 (GRCm39) I357K probably benign Het
Mr1 T C 1: 155,006,436 (GRCm39) T304A probably benign Het
Msh6 C T 17: 88,290,947 (GRCm39) R178C possibly damaging Het
Mtch1 T C 17: 29,566,565 (GRCm39) D66G probably benign Het
Mtmr7 A G 8: 41,062,040 (GRCm39) V15A probably benign Het
Mtss2 A T 8: 111,452,875 (GRCm39) H40L possibly damaging Het
Mxra8 A G 4: 155,925,331 (GRCm39) probably benign Het
Neurl2 T A 2: 164,674,739 (GRCm39) probably null Het
Nfia A C 4: 97,970,048 (GRCm39) T503P probably damaging Het
Noa1 T C 5: 77,454,179 (GRCm39) E487G possibly damaging Het
Nuak1 A T 10: 84,211,143 (GRCm39) V315D probably damaging Het
Nup205 A G 6: 35,207,505 (GRCm39) N1519S possibly damaging Het
Or10x1 T A 1: 174,196,966 (GRCm39) I161K probably damaging Het
Or1l4b T C 2: 37,036,266 (GRCm39) L14P probably damaging Het
Or1o1 T C 17: 37,716,589 (GRCm39) V50A probably benign Het
Or51f1e A G 7: 102,747,526 (GRCm39) I193V possibly damaging Het
Or6b13 G T 7: 139,782,340 (GRCm39) C114* probably null Het
Or9s18 G A 13: 65,300,493 (GRCm39) V152M possibly damaging Het
Peli1 T A 11: 21,098,528 (GRCm39) probably benign Het
Ppp6r1 A G 7: 4,646,206 (GRCm39) L175P probably damaging Het
Prkcd A G 14: 30,321,700 (GRCm39) L498P probably damaging Het
Prss30 T A 17: 24,191,769 (GRCm39) I251F probably benign Het
Psme3 A T 11: 101,207,907 (GRCm39) N21Y probably benign Het
Ptpra T C 2: 130,374,081 (GRCm39) Y271H probably damaging Het
Ralgapa1 T A 12: 55,745,588 (GRCm39) N1303Y probably damaging Het
Rims4 T C 2: 163,707,463 (GRCm39) I121V probably benign Het
Rnf123 A T 9: 107,933,290 (GRCm39) L1149Q probably damaging Het
Ryr3 T A 2: 112,738,807 (GRCm39) L593F probably damaging Het
Sec23b T C 2: 144,427,519 (GRCm39) F582S probably damaging Het
Sgpl1 T C 10: 60,940,297 (GRCm39) K335R probably benign Het
Sirpa C T 2: 129,451,163 (GRCm39) T141I probably damaging Het
Slit1 G T 19: 41,637,983 (GRCm39) A270E probably benign Het
Snap91 T C 9: 86,674,613 (GRCm39) T533A possibly damaging Het
Sphkap T G 1: 83,255,105 (GRCm39) E881D probably benign Het
Sptan1 C A 2: 29,901,054 (GRCm39) R1407S probably damaging Het
Tfdp1 A G 8: 13,423,895 (GRCm39) T353A probably benign Het
Ttyh1 A G 7: 4,125,533 (GRCm39) I62V possibly damaging Het
Vwde A T 6: 13,196,047 (GRCm39) V326D possibly damaging Het
Zfp398 T C 6: 47,836,446 (GRCm39) I82T possibly damaging Het
Zp1 A G 19: 10,896,198 (GRCm39) Y176H possibly damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCGCTTATGTAAATTTGTTGC -3'
(R):5'- AGATGTGGTTCTTGCCAGCG -3'

Sequencing Primer
(F):5'- GTCTGGAAAGCCTGCTATAA -3'
(R):5'- GCCAGCGTCTCTTGCATATTTAAC -3'
Posted On 2016-03-01