Incidental Mutation 'R4849:Evx2'
ID373363
Institutional Source Beutler Lab
Gene Symbol Evx2
Ensembl Gene ENSMUSG00000001815
Gene Nameeven-skipped homeobox 2
SynonymsEvx-2
MMRRC Submission 042461-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R4849 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location74652991-74659557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74659331 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 29 (D29G)
Ref Sequence ENSEMBL: ENSMUSP00000001867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001867] [ENSMUST00000173623]
Predicted Effect probably benign
Transcript: ENSMUST00000001867
AA Change: D29G

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000001867
Gene: ENSMUSG00000001815
AA Change: D29G

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
low complexity region 146 187 N/A INTRINSIC
HOX 190 252 5.66e-26 SMART
low complexity region 296 312 N/A INTRINSIC
low complexity region 348 387 N/A INTRINSIC
low complexity region 396 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173623
AA Change: D30G

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134131
Gene: ENSMUSG00000001815
AA Change: D30G

DomainStartEndE-ValueType
low complexity region 83 98 N/A INTRINSIC
low complexity region 107 112 N/A INTRINSIC
low complexity region 147 188 N/A INTRINSIC
HOX 191 253 5.66e-26 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 349 388 N/A INTRINSIC
low complexity region 397 434 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: This gene is located at the 5' end of the Hoxd gene cluster on chromosome 2. The encoded protein is a homeobox transcription factor that is related to the protein encoded by the Drosophila even-skipped (eve) gene, a member of the pair-rule class of segmentation genes. The encoded protein plays a role in limb morphogenesis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, male infertility, short limbs, and abnormalities in phalanx, carpal bone and metacarpal bone morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G T 7: 28,615,452 R239S possibly damaging Het
Angptl1 C A 1: 156,857,165 N301K probably benign Het
Ankrd26 T A 6: 118,532,296 T603S probably benign Het
App T C 16: 85,056,434 D252G unknown Het
Atxn3 A G 12: 101,934,368 S219P probably benign Het
Birc6 T C 17: 74,647,388 S3397P probably damaging Het
Bivm A G 1: 44,142,873 I414V possibly damaging Het
Cemip A G 7: 83,935,737 F1324L possibly damaging Het
Ckap5 T A 2: 91,615,271 N1724K probably damaging Het
Corin T A 5: 72,302,835 M1035L probably damaging Het
Ctnna3 T C 10: 64,873,315 I711T probably damaging Het
Cts6 A T 13: 61,201,601 W98R probably null Het
Dip2a A G 10: 76,294,533 S580P probably damaging Het
Dock6 A G 9: 21,811,772 probably null Het
Dusp15 T A 2: 152,949,082 T32S probably damaging Het
Eogt T A 6: 97,116,055 N387I probably damaging Het
Fat1 A G 8: 45,012,970 N1422S probably benign Het
Fat2 T C 11: 55,310,637 D537G probably damaging Het
Fat3 A C 9: 16,377,948 I93S probably benign Het
Fem1b T C 9: 62,797,294 E228G probably damaging Het
Fh1 A G 1: 175,620,506 T25A probably benign Het
Fndc3b A G 3: 27,459,948 W695R probably damaging Het
Gaa G A 11: 119,272,987 V222I possibly damaging Het
Ggnbp1 T C 17: 27,032,973 probably null Het
Gipc1 A G 8: 83,662,127 Y154C probably benign Het
Gm5356 G T 8: 89,187,042 noncoding transcript Het
Gnl1 T A 17: 35,987,711 probably null Het
Gpcpd1 C T 2: 132,534,099 G605R probably damaging Het
Guca1a T C 17: 47,394,737 T177A possibly damaging Het
Ifit1bl1 T C 19: 34,594,676 E127G probably damaging Het
Ift81 A T 5: 122,591,219 I350N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A G 6: 125,043,983 R23G probably damaging Het
Ins1 A G 19: 52,264,946 N108S probably damaging Het
Iqce A T 5: 140,693,459 M72K possibly damaging Het
Itga3 C A 11: 95,076,271 M22I probably benign Het
Kctd18 T C 1: 57,961,993 E201G probably damaging Het
Klc1 A G 12: 111,781,695 N344S probably damaging Het
Klrb1f A T 6: 129,056,384 I192F probably damaging Het
Klrg2 A T 6: 38,630,279 probably null Het
Kntc1 A C 5: 123,759,065 I164L probably benign Het
Ltf T A 9: 111,025,990 I357K probably benign Het
Mr1 T C 1: 155,130,690 T304A probably benign Het
Msh6 C T 17: 87,983,519 R178C possibly damaging Het
Mtch1 T C 17: 29,347,591 D66G probably benign Het
Mtmr7 A G 8: 40,608,997 V15A probably benign Het
Mtss1l A T 8: 110,726,243 H40L possibly damaging Het
Mxra8 A G 4: 155,840,874 probably benign Het
Myo3b T C 2: 70,244,909 L535P probably damaging Het
Neurl2 T A 2: 164,832,819 probably null Het
Nfia A C 4: 98,081,811 T503P probably damaging Het
Noa1 T C 5: 77,306,332 E487G possibly damaging Het
Nuak1 A T 10: 84,375,279 V315D probably damaging Het
Nup205 A G 6: 35,230,570 N1519S possibly damaging Het
Olfr107 T C 17: 37,405,698 V50A probably benign Het
Olfr364-ps1 T C 2: 37,146,254 L14P probably damaging Het
Olfr417 T A 1: 174,369,400 I161K probably damaging Het
Olfr466 G A 13: 65,152,679 V152M possibly damaging Het
Olfr524 G T 7: 140,202,427 C114* probably null Het
Olfr585 A G 7: 103,098,319 I193V possibly damaging Het
Peli1 T A 11: 21,148,528 probably benign Het
Ppp6r1 A G 7: 4,643,207 L175P probably damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Prss30 T A 17: 23,972,795 I251F probably benign Het
Psme3 A T 11: 101,317,081 N21Y probably benign Het
Ptpra T C 2: 130,532,161 Y271H probably damaging Het
Ralgapa1 T A 12: 55,698,803 N1303Y probably damaging Het
Rims4 T C 2: 163,865,543 I121V probably benign Het
Rnf123 A T 9: 108,056,091 L1149Q probably damaging Het
Ryr3 T A 2: 112,908,462 L593F probably damaging Het
Sec23b T C 2: 144,585,599 F582S probably damaging Het
Sgpl1 T C 10: 61,104,518 K335R probably benign Het
Sirpa C T 2: 129,609,243 T141I probably damaging Het
Slit1 G T 19: 41,649,544 A270E probably benign Het
Snap91 T C 9: 86,792,560 T533A possibly damaging Het
Sphkap T G 1: 83,277,384 E881D probably benign Het
Sptan1 C A 2: 30,011,042 R1407S probably damaging Het
Tfdp1 A G 8: 13,373,895 T353A probably benign Het
Ttyh1 A G 7: 4,122,534 I62V possibly damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp398 T C 6: 47,859,512 I82T possibly damaging Het
Zp1 A G 19: 10,918,834 Y176H possibly damaging Het
Other mutations in Evx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0133:Evx2 UTSW 2 74659082 missense possibly damaging 0.93
R0195:Evx2 UTSW 2 74659044 missense probably damaging 1.00
R0549:Evx2 UTSW 2 74659134 missense probably benign
R0610:Evx2 UTSW 2 74655987 missense probably benign 0.16
R0645:Evx2 UTSW 2 74657894 missense possibly damaging 0.81
R1608:Evx2 UTSW 2 74657851 missense probably damaging 1.00
R1769:Evx2 UTSW 2 74659157 missense probably benign 0.00
R2156:Evx2 UTSW 2 74656016 missense probably damaging 1.00
R2383:Evx2 UTSW 2 74658049 critical splice acceptor site probably null
R5407:Evx2 UTSW 2 74657826 missense probably damaging 1.00
R6167:Evx2 UTSW 2 74659262 missense probably damaging 0.96
R6704:Evx2 UTSW 2 74656155 missense probably damaging 1.00
R7447:Evx2 UTSW 2 74659104 missense probably benign 0.00
X0017:Evx2 UTSW 2 74657792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGAATAATGACTAGGCTTCTTG -3'
(R):5'- TGAATGAGAATCAGCCCTGGG -3'

Sequencing Primer
(F):5'- ATAATGACTAGGCTTCTTGCGGCTC -3'
(R):5'- ATTAAGACGGGACAGCCA -3'
Posted On2016-03-01