Incidental Mutation 'R4849:Vwde'
ID373383
Institutional Source Beutler Lab
Gene Symbol Vwde
Ensembl Gene ENSMUSG00000079679
Gene Namevon Willebrand factor D and EGF domains
SynonymsLOC232585
MMRRC Submission 042461-MU
Accession Numbers

Genbank: NM_001013757; MGI: 2685313 

Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R4849 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location13156299-13224965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13196048 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 326 (V326D)
Ref Sequence ENSEMBL: ENSMUSP00000058110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054530] [ENSMUST00000203074]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054530
AA Change: V326D

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058110
Gene: ENSMUSG00000079679
AA Change: V326D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:ZP 58 163 1e-5 BLAST
low complexity region 192 199 N/A INTRINSIC
VWD 420 588 1.51e-4 SMART
low complexity region 638 651 N/A INTRINSIC
Blast:EGF_like 890 918 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000203074
AA Change: V326D

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145311
Gene: ENSMUSG00000079679
AA Change: V326D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 192 199 N/A INTRINSIC
VWD 420 588 7.4e-7 SMART
low complexity region 638 651 N/A INTRINSIC
EGF_like 890 918 1.5e-1 SMART
EGF 1166 1217 8.5e-6 SMART
EGF_like 1182 1233 2.7e-2 SMART
EGF 1222 1254 9.7e-7 SMART
EGF_CA 1256 1295 5.3e-12 SMART
EGF 1446 1483 5e-2 SMART
EGF 1485 1514 3.8e-3 SMART
EGF 1517 1546 3.6e-3 SMART
EGF 1549 1578 8e-7 SMART
EGF 1581 1610 3.4e-3 SMART
EGF 1613 1642 1.5e-3 SMART
EGF 1645 1674 1.1e-5 SMART
EGF 1677 1706 2.5e-4 SMART
EGF 1709 1738 2.5e-3 SMART
EGF 1741 1770 1.8e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204339
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G T 7: 28,615,452 R239S possibly damaging Het
Angptl1 C A 1: 156,857,165 N301K probably benign Het
Ankrd26 T A 6: 118,532,296 T603S probably benign Het
App T C 16: 85,056,434 D252G unknown Het
Atxn3 A G 12: 101,934,368 S219P probably benign Het
Birc6 T C 17: 74,647,388 S3397P probably damaging Het
Bivm A G 1: 44,142,873 I414V possibly damaging Het
Cemip A G 7: 83,935,737 F1324L possibly damaging Het
Ckap5 T A 2: 91,615,271 N1724K probably damaging Het
Corin T A 5: 72,302,835 M1035L probably damaging Het
Ctnna3 T C 10: 64,873,315 I711T probably damaging Het
Cts6 A T 13: 61,201,601 W98R probably null Het
Dip2a A G 10: 76,294,533 S580P probably damaging Het
Dock6 A G 9: 21,811,772 probably null Het
Dusp15 T A 2: 152,949,082 T32S probably damaging Het
Eogt T A 6: 97,116,055 N387I probably damaging Het
Evx2 T C 2: 74,659,331 D29G probably benign Het
Fat1 A G 8: 45,012,970 N1422S probably benign Het
Fat2 T C 11: 55,310,637 D537G probably damaging Het
Fat3 A C 9: 16,377,948 I93S probably benign Het
Fem1b T C 9: 62,797,294 E228G probably damaging Het
Fh1 A G 1: 175,620,506 T25A probably benign Het
Fndc3b A G 3: 27,459,948 W695R probably damaging Het
Gaa G A 11: 119,272,987 V222I possibly damaging Het
Ggnbp1 T C 17: 27,032,973 probably null Het
Gipc1 A G 8: 83,662,127 Y154C probably benign Het
Gm5356 G T 8: 89,187,042 noncoding transcript Het
Gnl1 T A 17: 35,987,711 probably null Het
Gpcpd1 C T 2: 132,534,099 G605R probably damaging Het
Guca1a T C 17: 47,394,737 T177A possibly damaging Het
Ifit1bl1 T C 19: 34,594,676 E127G probably damaging Het
Ift81 A T 5: 122,591,219 I350N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A G 6: 125,043,983 R23G probably damaging Het
Ins1 A G 19: 52,264,946 N108S probably damaging Het
Iqce A T 5: 140,693,459 M72K possibly damaging Het
Itga3 C A 11: 95,076,271 M22I probably benign Het
Kctd18 T C 1: 57,961,993 E201G probably damaging Het
Klc1 A G 12: 111,781,695 N344S probably damaging Het
Klrb1f A T 6: 129,056,384 I192F probably damaging Het
Klrg2 A T 6: 38,630,279 probably null Het
Kntc1 A C 5: 123,759,065 I164L probably benign Het
Ltf T A 9: 111,025,990 I357K probably benign Het
Mr1 T C 1: 155,130,690 T304A probably benign Het
Msh6 C T 17: 87,983,519 R178C possibly damaging Het
Mtch1 T C 17: 29,347,591 D66G probably benign Het
Mtmr7 A G 8: 40,608,997 V15A probably benign Het
Mtss1l A T 8: 110,726,243 H40L possibly damaging Het
Mxra8 A G 4: 155,840,874 probably benign Het
Myo3b T C 2: 70,244,909 L535P probably damaging Het
Neurl2 T A 2: 164,832,819 probably null Het
Nfia A C 4: 98,081,811 T503P probably damaging Het
Noa1 T C 5: 77,306,332 E487G possibly damaging Het
Nuak1 A T 10: 84,375,279 V315D probably damaging Het
Nup205 A G 6: 35,230,570 N1519S possibly damaging Het
Olfr107 T C 17: 37,405,698 V50A probably benign Het
Olfr364-ps1 T C 2: 37,146,254 L14P probably damaging Het
Olfr417 T A 1: 174,369,400 I161K probably damaging Het
Olfr466 G A 13: 65,152,679 V152M possibly damaging Het
Olfr524 G T 7: 140,202,427 C114* probably null Het
Olfr585 A G 7: 103,098,319 I193V possibly damaging Het
Peli1 T A 11: 21,148,528 probably benign Het
Ppp6r1 A G 7: 4,643,207 L175P probably damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Prss30 T A 17: 23,972,795 I251F probably benign Het
Psme3 A T 11: 101,317,081 N21Y probably benign Het
Ptpra T C 2: 130,532,161 Y271H probably damaging Het
Ralgapa1 T A 12: 55,698,803 N1303Y probably damaging Het
Rims4 T C 2: 163,865,543 I121V probably benign Het
Rnf123 A T 9: 108,056,091 L1149Q probably damaging Het
Ryr3 T A 2: 112,908,462 L593F probably damaging Het
Sec23b T C 2: 144,585,599 F582S probably damaging Het
Sgpl1 T C 10: 61,104,518 K335R probably benign Het
Sirpa C T 2: 129,609,243 T141I probably damaging Het
Slit1 G T 19: 41,649,544 A270E probably benign Het
Snap91 T C 9: 86,792,560 T533A possibly damaging Het
Sphkap T G 1: 83,277,384 E881D probably benign Het
Sptan1 C A 2: 30,011,042 R1407S probably damaging Het
Tfdp1 A G 8: 13,373,895 T353A probably benign Het
Ttyh1 A G 7: 4,122,534 I62V possibly damaging Het
Zfp398 T C 6: 47,859,512 I82T possibly damaging Het
Zp1 A G 19: 10,918,834 Y176H possibly damaging Het
Other mutations in Vwde
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Vwde APN 6 13187412 missense probably benign 0.00
IGL01391:Vwde APN 6 13190527 missense probably benign 0.07
IGL01432:Vwde APN 6 13193240 missense probably benign 0.18
IGL01611:Vwde APN 6 13219978 missense probably damaging 1.00
IGL01835:Vwde APN 6 13186824 missense probably benign 0.43
IGL01993:Vwde APN 6 13219978 missense possibly damaging 0.89
IGL01997:Vwde APN 6 13215706 missense probably damaging 1.00
IGL02390:Vwde APN 6 13190685 missense probably damaging 1.00
IGL02612:Vwde APN 6 13187149 missense probably damaging 1.00
IGL02723:Vwde APN 6 13205760 missense probably damaging 0.99
IGL02731:Vwde APN 6 13192614 missense probably damaging 1.00
IGL02869:Vwde APN 6 13187137 missense probably damaging 1.00
IGL02981:Vwde APN 6 13193113 missense possibly damaging 0.84
IGL03031:Vwde APN 6 13208382 missense probably benign 0.10
IGL03180:Vwde APN 6 13205765 missense probably damaging 1.00
IGL03182:Vwde APN 6 13187139 missense probably damaging 1.00
willy_brandt UTSW 6 13208405 splice site probably null
C9142:Vwde UTSW 6 13168054 splice site probably benign
R0089:Vwde UTSW 6 13220005 missense probably damaging 1.00
R0244:Vwde UTSW 6 13193126 missense probably benign 0.16
R0355:Vwde UTSW 6 13187807 splice site probably benign
R0455:Vwde UTSW 6 13187529 missense probably benign 0.03
R0465:Vwde UTSW 6 13215806 splice site probably benign
R0946:Vwde UTSW 6 13187875 missense probably damaging 1.00
R1087:Vwde UTSW 6 13186804 missense probably damaging 1.00
R1236:Vwde UTSW 6 13187153 nonsense probably null
R1738:Vwde UTSW 6 13190724 missense probably damaging 1.00
R1891:Vwde UTSW 6 13187455 missense probably damaging 0.98
R2014:Vwde UTSW 6 13208338 missense possibly damaging 0.91
R2015:Vwde UTSW 6 13208338 missense possibly damaging 0.91
R2303:Vwde UTSW 6 13215807 splice site probably benign
R3439:Vwde UTSW 6 13208375 missense probably damaging 0.98
R3688:Vwde UTSW 6 13186892 missense probably damaging 0.96
R4457:Vwde UTSW 6 13196101 missense probably damaging 1.00
R4755:Vwde UTSW 6 13205852 missense possibly damaging 0.94
R4850:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4851:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4853:Vwde UTSW 6 13215640 missense probably damaging 1.00
R4951:Vwde UTSW 6 13187139 missense probably damaging 1.00
R5023:Vwde UTSW 6 13192642 missense possibly damaging 0.48
R5057:Vwde UTSW 6 13192642 missense possibly damaging 0.48
R5060:Vwde UTSW 6 13208324 splice site probably null
R5126:Vwde UTSW 6 13187260 missense probably benign 0.04
R5154:Vwde UTSW 6 13215758 missense probably benign 0.01
R5277:Vwde UTSW 6 13186996 missense probably benign 0.03
R5432:Vwde UTSW 6 13190592 missense probably damaging 1.00
R5436:Vwde UTSW 6 13190628 missense probably damaging 1.00
R5472:Vwde UTSW 6 13193118 missense probably benign 0.00
R5518:Vwde UTSW 6 13186938 missense probably benign 0.00
R5791:Vwde UTSW 6 13195986 nonsense probably null
R6045:Vwde UTSW 6 13219936 missense probably damaging 1.00
R6262:Vwde UTSW 6 13205021 missense probably damaging 1.00
R6482:Vwde UTSW 6 13205844 missense probably damaging 1.00
R6500:Vwde UTSW 6 13208405 splice site probably null
R6562:Vwde UTSW 6 13193123 missense possibly damaging 0.84
R6905:Vwde UTSW 6 13205927 missense probably damaging 1.00
R7021:Vwde UTSW 6 13186906 missense probably damaging 1.00
R7103:Vwde UTSW 6 13215800 missense probably benign 0.03
R7356:Vwde UTSW 6 13192642 missense probably damaging 0.96
R7434:Vwde UTSW 6 13187640 missense probably benign 0.00
R7492:Vwde UTSW 6 13204981 missense probably null 1.00
R8026:Vwde UTSW 6 13205783 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCTATTGTTTGACGTAAGCAAGG -3'
(R):5'- CCTAAGCAAAAGATAGCCTACTGGG -3'

Sequencing Primer
(F):5'- GGACTCTCTGGAAAACAGA -3'
(R):5'- TAGCCTACTGGGGTAACAAAAAC -3'
Posted On2016-03-01