Incidental Mutation 'R4849:Cemip'
ID373393
Institutional Source Beutler Lab
Gene Symbol Cemip
Ensembl Gene ENSMUSG00000052353
Gene Namecell migration inducing protein, hyaluronan binding
Synonyms6330404C01Rik, 9930013L23Rik, 12H19.01.T7
MMRRC Submission 042461-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4849 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location83932857-84086502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83935737 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1324 (F1324L)
Ref Sequence ENSEMBL: ENSMUSP00000063277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064174]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064174
AA Change: F1324L

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: F1324L

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
G8 44 166 9.01e-42 SMART
Pfam:ILEI 187 281 2.1e-28 PFAM
Pfam:Mucin2_WxxW 324 403 1.2e-13 PFAM
PbH1 572 594 7.34e3 SMART
PbH1 595 617 3.73e3 SMART
PbH1 719 741 4.11e3 SMART
PbH1 798 819 6.96e2 SMART
Blast:PbH1 844 882 7e-17 BLAST
Blast:PbH1 917 952 2e-15 BLAST
Pfam:ILEI 1244 1334 2.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145171
Meta Mutation Damage Score 0.0905 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G T 7: 28,615,452 R239S possibly damaging Het
Angptl1 C A 1: 156,857,165 N301K probably benign Het
Ankrd26 T A 6: 118,532,296 T603S probably benign Het
App T C 16: 85,056,434 D252G unknown Het
Atxn3 A G 12: 101,934,368 S219P probably benign Het
Birc6 T C 17: 74,647,388 S3397P probably damaging Het
Bivm A G 1: 44,142,873 I414V possibly damaging Het
Ckap5 T A 2: 91,615,271 N1724K probably damaging Het
Corin T A 5: 72,302,835 M1035L probably damaging Het
Ctnna3 T C 10: 64,873,315 I711T probably damaging Het
Cts6 A T 13: 61,201,601 W98R probably null Het
Dip2a A G 10: 76,294,533 S580P probably damaging Het
Dock6 A G 9: 21,811,772 probably null Het
Dusp15 T A 2: 152,949,082 T32S probably damaging Het
Eogt T A 6: 97,116,055 N387I probably damaging Het
Evx2 T C 2: 74,659,331 D29G probably benign Het
Fat1 A G 8: 45,012,970 N1422S probably benign Het
Fat2 T C 11: 55,310,637 D537G probably damaging Het
Fat3 A C 9: 16,377,948 I93S probably benign Het
Fem1b T C 9: 62,797,294 E228G probably damaging Het
Fh1 A G 1: 175,620,506 T25A probably benign Het
Fndc3b A G 3: 27,459,948 W695R probably damaging Het
Gaa G A 11: 119,272,987 V222I possibly damaging Het
Ggnbp1 T C 17: 27,032,973 probably null Het
Gipc1 A G 8: 83,662,127 Y154C probably benign Het
Gm5356 G T 8: 89,187,042 noncoding transcript Het
Gnl1 T A 17: 35,987,711 probably null Het
Gpcpd1 C T 2: 132,534,099 G605R probably damaging Het
Guca1a T C 17: 47,394,737 T177A possibly damaging Het
Ifit1bl1 T C 19: 34,594,676 E127G probably damaging Het
Ift81 A T 5: 122,591,219 I350N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A G 6: 125,043,983 R23G probably damaging Het
Ins1 A G 19: 52,264,946 N108S probably damaging Het
Iqce A T 5: 140,693,459 M72K possibly damaging Het
Itga3 C A 11: 95,076,271 M22I probably benign Het
Kctd18 T C 1: 57,961,993 E201G probably damaging Het
Klc1 A G 12: 111,781,695 N344S probably damaging Het
Klrb1f A T 6: 129,056,384 I192F probably damaging Het
Klrg2 A T 6: 38,630,279 probably null Het
Kntc1 A C 5: 123,759,065 I164L probably benign Het
Ltf T A 9: 111,025,990 I357K probably benign Het
Mr1 T C 1: 155,130,690 T304A probably benign Het
Msh6 C T 17: 87,983,519 R178C possibly damaging Het
Mtch1 T C 17: 29,347,591 D66G probably benign Het
Mtmr7 A G 8: 40,608,997 V15A probably benign Het
Mtss1l A T 8: 110,726,243 H40L possibly damaging Het
Mxra8 A G 4: 155,840,874 probably benign Het
Myo3b T C 2: 70,244,909 L535P probably damaging Het
Neurl2 T A 2: 164,832,819 probably null Het
Nfia A C 4: 98,081,811 T503P probably damaging Het
Noa1 T C 5: 77,306,332 E487G possibly damaging Het
Nuak1 A T 10: 84,375,279 V315D probably damaging Het
Nup205 A G 6: 35,230,570 N1519S possibly damaging Het
Olfr107 T C 17: 37,405,698 V50A probably benign Het
Olfr364-ps1 T C 2: 37,146,254 L14P probably damaging Het
Olfr417 T A 1: 174,369,400 I161K probably damaging Het
Olfr466 G A 13: 65,152,679 V152M possibly damaging Het
Olfr524 G T 7: 140,202,427 C114* probably null Het
Olfr585 A G 7: 103,098,319 I193V possibly damaging Het
Peli1 T A 11: 21,148,528 probably benign Het
Ppp6r1 A G 7: 4,643,207 L175P probably damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Prss30 T A 17: 23,972,795 I251F probably benign Het
Psme3 A T 11: 101,317,081 N21Y probably benign Het
Ptpra T C 2: 130,532,161 Y271H probably damaging Het
Ralgapa1 T A 12: 55,698,803 N1303Y probably damaging Het
Rims4 T C 2: 163,865,543 I121V probably benign Het
Rnf123 A T 9: 108,056,091 L1149Q probably damaging Het
Ryr3 T A 2: 112,908,462 L593F probably damaging Het
Sec23b T C 2: 144,585,599 F582S probably damaging Het
Sgpl1 T C 10: 61,104,518 K335R probably benign Het
Sirpa C T 2: 129,609,243 T141I probably damaging Het
Slit1 G T 19: 41,649,544 A270E probably benign Het
Snap91 T C 9: 86,792,560 T533A possibly damaging Het
Sphkap T G 1: 83,277,384 E881D probably benign Het
Sptan1 C A 2: 30,011,042 R1407S probably damaging Het
Tfdp1 A G 8: 13,373,895 T353A probably benign Het
Ttyh1 A G 7: 4,122,534 I62V possibly damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp398 T C 6: 47,859,512 I82T possibly damaging Het
Zp1 A G 19: 10,918,834 Y176H possibly damaging Het
Other mutations in Cemip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Cemip APN 7 83947280 missense possibly damaging 0.63
IGL01520:Cemip APN 7 83948622 missense probably benign 0.27
IGL01646:Cemip APN 7 83983232 missense possibly damaging 0.81
IGL02057:Cemip APN 7 83987453 missense probably damaging 1.00
IGL02058:Cemip APN 7 83997292 missense probably damaging 0.99
IGL02120:Cemip APN 7 83951563 missense probably damaging 0.99
IGL02278:Cemip APN 7 83937438 missense probably damaging 1.00
IGL02331:Cemip APN 7 83963984 critical splice donor site probably null
IGL02366:Cemip APN 7 83943641 missense probably benign 0.08
IGL02434:Cemip APN 7 83955284 missense probably damaging 0.98
IGL02622:Cemip APN 7 83964175 missense probably damaging 1.00
IGL02958:Cemip APN 7 83975055 missense probably damaging 0.99
IGL02979:Cemip APN 7 84003306 splice site probably benign
IGL03280:Cemip APN 7 83987330 splice site probably benign
IGL03400:Cemip APN 7 83958516 missense probably damaging 0.96
IGL03134:Cemip UTSW 7 83999237 missense probably damaging 1.00
PIT4618001:Cemip UTSW 7 83943939 missense probably benign 0.07
R0149:Cemip UTSW 7 83964010 missense probably benign
R0212:Cemip UTSW 7 83973190 missense probably damaging 0.99
R0361:Cemip UTSW 7 83964010 missense probably benign
R0565:Cemip UTSW 7 83964110 missense probably damaging 0.99
R0727:Cemip UTSW 7 83961578 missense probably benign 0.00
R1342:Cemip UTSW 7 83944075 nonsense probably null
R1456:Cemip UTSW 7 83998510 missense possibly damaging 0.96
R1526:Cemip UTSW 7 83951440 missense probably damaging 1.00
R1676:Cemip UTSW 7 83964038 missense possibly damaging 0.77
R1718:Cemip UTSW 7 83935658 missense probably benign 0.00
R2234:Cemip UTSW 7 83998562 missense probably benign 0.02
R2513:Cemip UTSW 7 83942025 missense probably benign 0.11
R3788:Cemip UTSW 7 83943898 missense probably damaging 1.00
R3964:Cemip UTSW 7 83951509 missense probably benign 0.43
R3966:Cemip UTSW 7 83951509 missense probably benign 0.43
R4436:Cemip UTSW 7 83987429 missense probably null 0.43
R4584:Cemip UTSW 7 83958539 missense probably damaging 1.00
R4601:Cemip UTSW 7 83951618 missense probably damaging 0.98
R4717:Cemip UTSW 7 83947280 missense probably damaging 0.97
R4767:Cemip UTSW 7 83973306 missense probably damaging 1.00
R4822:Cemip UTSW 7 83973241 missense probably benign 0.27
R4910:Cemip UTSW 7 83997411 missense probably damaging 1.00
R4911:Cemip UTSW 7 83983253 missense probably damaging 1.00
R4922:Cemip UTSW 7 83947100 intron probably benign
R4924:Cemip UTSW 7 83952938 missense probably damaging 1.00
R5090:Cemip UTSW 7 83942135 missense probably damaging 1.00
R5310:Cemip UTSW 7 83992033 missense probably damaging 1.00
R5327:Cemip UTSW 7 83955301 missense probably damaging 0.99
R5378:Cemip UTSW 7 83958525 missense probably damaging 1.00
R5444:Cemip UTSW 7 83982291 missense probably damaging 0.98
R5644:Cemip UTSW 7 83989184 missense probably benign 0.03
R5688:Cemip UTSW 7 83961641 missense probably damaging 1.00
R5714:Cemip UTSW 7 83975179 missense probably damaging 1.00
R6170:Cemip UTSW 7 83947230 missense possibly damaging 0.89
R6505:Cemip UTSW 7 83951597 nonsense probably null
R6713:Cemip UTSW 7 83943637 missense probably benign 0.03
R6767:Cemip UTSW 7 83998624 missense probably damaging 1.00
R6817:Cemip UTSW 7 83987992 missense probably damaging 1.00
R6896:Cemip UTSW 7 83998576 missense probably damaging 1.00
R6945:Cemip UTSW 7 83998547 missense probably damaging 1.00
R7236:Cemip UTSW 7 83948804 splice site probably null
R7410:Cemip UTSW 7 83952834 missense probably damaging 1.00
R7483:Cemip UTSW 7 83998576 missense probably damaging 0.99
R7734:Cemip UTSW 7 83957664 nonsense probably null
R8005:Cemip UTSW 7 84003408 start gained probably benign
RF008:Cemip UTSW 7 83961635 missense probably damaging 0.99
T0970:Cemip UTSW 7 83983146 missense probably damaging 0.99
X0067:Cemip UTSW 7 83947208 missense probably damaging 0.98
Z1177:Cemip UTSW 7 83947296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATATCTGTCCCTTAGCCCAGC -3'
(R):5'- CATGAGGCTCAAGAGTGATAGC -3'

Sequencing Primer
(F):5'- TCCCTTAGCCCAGCAGAGC -3'
(R):5'- GGCTCAAGAGTGATAGCTACAAACC -3'
Posted On2016-03-01