Incidental Mutation 'R4849:Tfdp1'
ID373396
Institutional Source Beutler Lab
Gene Symbol Tfdp1
Ensembl Gene ENSMUSG00000038482
Gene Nametranscription factor Dp 1
SynonymsDrtf1, Dp1
MMRRC Submission 042461-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4849 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13338751-13378448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13373895 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 353 (T353A)
Ref Sequence ENSEMBL: ENSMUSP00000147881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170909] [ENSMUST00000209282] [ENSMUST00000209396] [ENSMUST00000209885] [ENSMUST00000209945] [ENSMUST00000210165] [ENSMUST00000210501]
Predicted Effect probably benign
Transcript: ENSMUST00000170909
AA Change: T353A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127952
Gene: ENSMUSG00000038482
AA Change: T353A

DomainStartEndE-ValueType
E2F_TDP 111 193 1.51e-34 SMART
DP 200 344 4.07e-90 SMART
low complexity region 395 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209282
Predicted Effect probably benign
Transcript: ENSMUST00000209396
AA Change: T233A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209885
AA Change: T353A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209945
Predicted Effect probably benign
Transcript: ENSMUST00000210165
Predicted Effect probably benign
Transcript: ENSMUST00000210501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211606
Meta Mutation Damage Score 0.0617 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transcription factors that heterodimerize with E2F proteins to enhance their DNA-binding activity and promote transcription from E2F target genes. The encoded protein functions as part of this complex to control the transcriptional activity of numerous genes involved in cell cycle progression from G1 to S phase. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1, 15, and X.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced expansion of the ectoplacental cone and chorion, small yolk sacs, and impaired endoreduplication in trophoblast giant cells. Mutants die by embryonic day 12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G T 7: 28,615,452 R239S possibly damaging Het
Angptl1 C A 1: 156,857,165 N301K probably benign Het
Ankrd26 T A 6: 118,532,296 T603S probably benign Het
App T C 16: 85,056,434 D252G unknown Het
Atxn3 A G 12: 101,934,368 S219P probably benign Het
Birc6 T C 17: 74,647,388 S3397P probably damaging Het
Bivm A G 1: 44,142,873 I414V possibly damaging Het
Cemip A G 7: 83,935,737 F1324L possibly damaging Het
Ckap5 T A 2: 91,615,271 N1724K probably damaging Het
Corin T A 5: 72,302,835 M1035L probably damaging Het
Ctnna3 T C 10: 64,873,315 I711T probably damaging Het
Cts6 A T 13: 61,201,601 W98R probably null Het
Dip2a A G 10: 76,294,533 S580P probably damaging Het
Dock6 A G 9: 21,811,772 probably null Het
Dusp15 T A 2: 152,949,082 T32S probably damaging Het
Eogt T A 6: 97,116,055 N387I probably damaging Het
Evx2 T C 2: 74,659,331 D29G probably benign Het
Fat1 A G 8: 45,012,970 N1422S probably benign Het
Fat2 T C 11: 55,310,637 D537G probably damaging Het
Fat3 A C 9: 16,377,948 I93S probably benign Het
Fem1b T C 9: 62,797,294 E228G probably damaging Het
Fh1 A G 1: 175,620,506 T25A probably benign Het
Fndc3b A G 3: 27,459,948 W695R probably damaging Het
Gaa G A 11: 119,272,987 V222I possibly damaging Het
Ggnbp1 T C 17: 27,032,973 probably null Het
Gipc1 A G 8: 83,662,127 Y154C probably benign Het
Gm5356 G T 8: 89,187,042 noncoding transcript Het
Gnl1 T A 17: 35,987,711 probably null Het
Gpcpd1 C T 2: 132,534,099 G605R probably damaging Het
Guca1a T C 17: 47,394,737 T177A possibly damaging Het
Ifit1bl1 T C 19: 34,594,676 E127G probably damaging Het
Ift81 A T 5: 122,591,219 I350N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A G 6: 125,043,983 R23G probably damaging Het
Ins1 A G 19: 52,264,946 N108S probably damaging Het
Iqce A T 5: 140,693,459 M72K possibly damaging Het
Itga3 C A 11: 95,076,271 M22I probably benign Het
Kctd18 T C 1: 57,961,993 E201G probably damaging Het
Klc1 A G 12: 111,781,695 N344S probably damaging Het
Klrb1f A T 6: 129,056,384 I192F probably damaging Het
Klrg2 A T 6: 38,630,279 probably null Het
Kntc1 A C 5: 123,759,065 I164L probably benign Het
Ltf T A 9: 111,025,990 I357K probably benign Het
Mr1 T C 1: 155,130,690 T304A probably benign Het
Msh6 C T 17: 87,983,519 R178C possibly damaging Het
Mtch1 T C 17: 29,347,591 D66G probably benign Het
Mtmr7 A G 8: 40,608,997 V15A probably benign Het
Mtss1l A T 8: 110,726,243 H40L possibly damaging Het
Mxra8 A G 4: 155,840,874 probably benign Het
Myo3b T C 2: 70,244,909 L535P probably damaging Het
Neurl2 T A 2: 164,832,819 probably null Het
Nfia A C 4: 98,081,811 T503P probably damaging Het
Noa1 T C 5: 77,306,332 E487G possibly damaging Het
Nuak1 A T 10: 84,375,279 V315D probably damaging Het
Nup205 A G 6: 35,230,570 N1519S possibly damaging Het
Olfr107 T C 17: 37,405,698 V50A probably benign Het
Olfr364-ps1 T C 2: 37,146,254 L14P probably damaging Het
Olfr417 T A 1: 174,369,400 I161K probably damaging Het
Olfr466 G A 13: 65,152,679 V152M possibly damaging Het
Olfr524 G T 7: 140,202,427 C114* probably null Het
Olfr585 A G 7: 103,098,319 I193V possibly damaging Het
Peli1 T A 11: 21,148,528 probably benign Het
Ppp6r1 A G 7: 4,643,207 L175P probably damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Prss30 T A 17: 23,972,795 I251F probably benign Het
Psme3 A T 11: 101,317,081 N21Y probably benign Het
Ptpra T C 2: 130,532,161 Y271H probably damaging Het
Ralgapa1 T A 12: 55,698,803 N1303Y probably damaging Het
Rims4 T C 2: 163,865,543 I121V probably benign Het
Rnf123 A T 9: 108,056,091 L1149Q probably damaging Het
Ryr3 T A 2: 112,908,462 L593F probably damaging Het
Sec23b T C 2: 144,585,599 F582S probably damaging Het
Sgpl1 T C 10: 61,104,518 K335R probably benign Het
Sirpa C T 2: 129,609,243 T141I probably damaging Het
Slit1 G T 19: 41,649,544 A270E probably benign Het
Snap91 T C 9: 86,792,560 T533A possibly damaging Het
Sphkap T G 1: 83,277,384 E881D probably benign Het
Sptan1 C A 2: 30,011,042 R1407S probably damaging Het
Ttyh1 A G 7: 4,122,534 I62V possibly damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp398 T C 6: 47,859,512 I82T possibly damaging Het
Zp1 A G 19: 10,918,834 Y176H possibly damaging Het
Other mutations in Tfdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Tfdp1 APN 8 13369546 missense possibly damaging 0.95
gangly UTSW 8 13357038 splice site probably null
PIT1430001:Tfdp1 UTSW 8 13372526 missense probably benign 0.35
R1139:Tfdp1 UTSW 8 13373000 missense probably benign 0.14
R1264:Tfdp1 UTSW 8 13373837 splice site probably benign
R1485:Tfdp1 UTSW 8 13370917 missense probably damaging 0.99
R1967:Tfdp1 UTSW 8 13373039 missense possibly damaging 0.59
R4965:Tfdp1 UTSW 8 13373073 missense probably damaging 0.99
R5257:Tfdp1 UTSW 8 13369529 missense possibly damaging 0.92
R5258:Tfdp1 UTSW 8 13369529 missense possibly damaging 0.92
R5895:Tfdp1 UTSW 8 13357038 splice site probably null
R6785:Tfdp1 UTSW 8 13370485 missense probably damaging 0.99
R6785:Tfdp1 UTSW 8 13377233 missense possibly damaging 0.85
R6786:Tfdp1 UTSW 8 13370485 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTCACATTCTGGGTTTCAGG -3'
(R):5'- GAACACAGGTAGGTTTGCGC -3'

Sequencing Primer
(F):5'- CACATTCTGGGTTTCAGGAGTTTTG -3'
(R):5'- ACCATGAATTACTTAATTGGGGGCG -3'
Posted On2016-03-01