Incidental Mutation 'R4849:Ifit1bl1'
ID373433
Institutional Source Beutler Lab
Gene Symbol Ifit1bl1
Ensembl Gene ENSMUSG00000079339
Gene Nameinterferon induced protein with tetratricpeptide repeats 1B like 1
SynonymsGm14446
MMRRC Submission 042461-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4849 (G1)
Quality Score144
Status Validated
Chromosome19
Chromosomal Location34592888-34601968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34594676 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 127 (E127G)
Ref Sequence ENSEMBL: ENSMUSP00000132781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112467] [ENSMUST00000168254]
Predicted Effect probably damaging
Transcript: ENSMUST00000112467
AA Change: E127G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108086
Gene: ENSMUSG00000079339
AA Change: E127G

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168254
AA Change: E127G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132781
Gene: ENSMUSG00000079339
AA Change: E127G

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Meta Mutation Damage Score 0.1035 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G T 7: 28,615,452 R239S possibly damaging Het
Angptl1 C A 1: 156,857,165 N301K probably benign Het
Ankrd26 T A 6: 118,532,296 T603S probably benign Het
App T C 16: 85,056,434 D252G unknown Het
Atxn3 A G 12: 101,934,368 S219P probably benign Het
Birc6 T C 17: 74,647,388 S3397P probably damaging Het
Bivm A G 1: 44,142,873 I414V possibly damaging Het
Cemip A G 7: 83,935,737 F1324L possibly damaging Het
Ckap5 T A 2: 91,615,271 N1724K probably damaging Het
Corin T A 5: 72,302,835 M1035L probably damaging Het
Ctnna3 T C 10: 64,873,315 I711T probably damaging Het
Cts6 A T 13: 61,201,601 W98R probably null Het
Dip2a A G 10: 76,294,533 S580P probably damaging Het
Dock6 A G 9: 21,811,772 probably null Het
Dusp15 T A 2: 152,949,082 T32S probably damaging Het
Eogt T A 6: 97,116,055 N387I probably damaging Het
Evx2 T C 2: 74,659,331 D29G probably benign Het
Fat1 A G 8: 45,012,970 N1422S probably benign Het
Fat2 T C 11: 55,310,637 D537G probably damaging Het
Fat3 A C 9: 16,377,948 I93S probably benign Het
Fem1b T C 9: 62,797,294 E228G probably damaging Het
Fh1 A G 1: 175,620,506 T25A probably benign Het
Fndc3b A G 3: 27,459,948 W695R probably damaging Het
Gaa G A 11: 119,272,987 V222I possibly damaging Het
Ggnbp1 T C 17: 27,032,973 probably null Het
Gipc1 A G 8: 83,662,127 Y154C probably benign Het
Gm5356 G T 8: 89,187,042 noncoding transcript Het
Gnl1 T A 17: 35,987,711 probably null Het
Gpcpd1 C T 2: 132,534,099 G605R probably damaging Het
Guca1a T C 17: 47,394,737 T177A possibly damaging Het
Ift81 A T 5: 122,591,219 I350N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A G 6: 125,043,983 R23G probably damaging Het
Ins1 A G 19: 52,264,946 N108S probably damaging Het
Iqce A T 5: 140,693,459 M72K possibly damaging Het
Itga3 C A 11: 95,076,271 M22I probably benign Het
Kctd18 T C 1: 57,961,993 E201G probably damaging Het
Klc1 A G 12: 111,781,695 N344S probably damaging Het
Klrb1f A T 6: 129,056,384 I192F probably damaging Het
Klrg2 A T 6: 38,630,279 probably null Het
Kntc1 A C 5: 123,759,065 I164L probably benign Het
Ltf T A 9: 111,025,990 I357K probably benign Het
Mr1 T C 1: 155,130,690 T304A probably benign Het
Msh6 C T 17: 87,983,519 R178C possibly damaging Het
Mtch1 T C 17: 29,347,591 D66G probably benign Het
Mtmr7 A G 8: 40,608,997 V15A probably benign Het
Mtss1l A T 8: 110,726,243 H40L possibly damaging Het
Mxra8 A G 4: 155,840,874 probably benign Het
Myo3b T C 2: 70,244,909 L535P probably damaging Het
Neurl2 T A 2: 164,832,819 probably null Het
Nfia A C 4: 98,081,811 T503P probably damaging Het
Noa1 T C 5: 77,306,332 E487G possibly damaging Het
Nuak1 A T 10: 84,375,279 V315D probably damaging Het
Nup205 A G 6: 35,230,570 N1519S possibly damaging Het
Olfr107 T C 17: 37,405,698 V50A probably benign Het
Olfr364-ps1 T C 2: 37,146,254 L14P probably damaging Het
Olfr417 T A 1: 174,369,400 I161K probably damaging Het
Olfr466 G A 13: 65,152,679 V152M possibly damaging Het
Olfr524 G T 7: 140,202,427 C114* probably null Het
Olfr585 A G 7: 103,098,319 I193V possibly damaging Het
Peli1 T A 11: 21,148,528 probably benign Het
Ppp6r1 A G 7: 4,643,207 L175P probably damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Prss30 T A 17: 23,972,795 I251F probably benign Het
Psme3 A T 11: 101,317,081 N21Y probably benign Het
Ptpra T C 2: 130,532,161 Y271H probably damaging Het
Ralgapa1 T A 12: 55,698,803 N1303Y probably damaging Het
Rims4 T C 2: 163,865,543 I121V probably benign Het
Rnf123 A T 9: 108,056,091 L1149Q probably damaging Het
Ryr3 T A 2: 112,908,462 L593F probably damaging Het
Sec23b T C 2: 144,585,599 F582S probably damaging Het
Sgpl1 T C 10: 61,104,518 K335R probably benign Het
Sirpa C T 2: 129,609,243 T141I probably damaging Het
Slit1 G T 19: 41,649,544 A270E probably benign Het
Snap91 T C 9: 86,792,560 T533A possibly damaging Het
Sphkap T G 1: 83,277,384 E881D probably benign Het
Sptan1 C A 2: 30,011,042 R1407S probably damaging Het
Tfdp1 A G 8: 13,373,895 T353A probably benign Het
Ttyh1 A G 7: 4,122,534 I62V possibly damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp398 T C 6: 47,859,512 I82T possibly damaging Het
Zp1 A G 19: 10,918,834 Y176H possibly damaging Het
Other mutations in Ifit1bl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4544001:Ifit1bl1 UTSW 19 34594015 missense possibly damaging 0.79
R0420:Ifit1bl1 UTSW 19 34594514 missense probably damaging 1.00
R1161:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1310:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1483:Ifit1bl1 UTSW 19 34594641 missense possibly damaging 0.88
R1606:Ifit1bl1 UTSW 19 34594044 missense probably benign 0.00
R1753:Ifit1bl1 UTSW 19 34593860 missense probably benign 0.15
R1778:Ifit1bl1 UTSW 19 34594193 missense probably damaging 1.00
R2204:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2205:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2442:Ifit1bl1 UTSW 19 34594889 missense probably benign 0.00
R2858:Ifit1bl1 UTSW 19 34594322 missense probably benign 0.01
R3422:Ifit1bl1 UTSW 19 34593950 missense probably benign 0.04
R4081:Ifit1bl1 UTSW 19 34594640 missense possibly damaging 0.63
R4125:Ifit1bl1 UTSW 19 34594788 missense probably damaging 0.99
R4616:Ifit1bl1 UTSW 19 34594610 missense probably damaging 1.00
R4731:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R4732:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R5026:Ifit1bl1 UTSW 19 34593893 missense probably damaging 1.00
R5049:Ifit1bl1 UTSW 19 34594081 nonsense probably null
R5414:Ifit1bl1 UTSW 19 34593924 missense probably damaging 0.99
R5561:Ifit1bl1 UTSW 19 34593797 nonsense probably null
R5586:Ifit1bl1 UTSW 19 34594277 missense probably damaging 0.98
R6345:Ifit1bl1 UTSW 19 34594170 nonsense probably null
R6382:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R6515:Ifit1bl1 UTSW 19 34594499 missense probably damaging 1.00
R7073:Ifit1bl1 UTSW 19 34599267 critical splice donor site probably null
R7180:Ifit1bl1 UTSW 19 34593902 missense probably damaging 1.00
R7210:Ifit1bl1 UTSW 19 34594164 missense probably benign 0.00
R7665:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R7724:Ifit1bl1 UTSW 19 34594005 missense probably benign 0.00
R7783:Ifit1bl1 UTSW 19 34593936 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGCCAGCATTGTACTCAGG -3'
(R):5'- TTCTTTGATGCCAGCTACAGC -3'

Sequencing Primer
(F):5'- GCCAGCATTGTACTCAGGGTTTTC -3'
(R):5'- ATCGGGATGCACAACCTCCTG -3'
Posted On2016-03-01