Mutagenetix > Incidental Mutation

Incidental Mutation 'R4850:Rp1'

373436

Institutional Source

Beutler Lab

Gene Symbol

Rp1

Ensembl Gene

ENSMUSG00000025900

Gene Name

retinitis pigmentosa 1 (human)

Synonyms

Dcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h

MMRRC Submission

042462-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R4850 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3999557-4409241 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4348675 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Methionine at position 738 (K738M)

Ref Sequence

ENSEMBL: ENSMUSP00000027032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]

AlphaFold

P56716

Predicted Effect

probably damaging
Transcript: ENSMUST00000027032
AA Change: K738M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: K738M

Domain	Start	End	E-Value	Type
DCX	30	117	4.37e-39	SMART
low complexity region	120	133	N/A	INTRINSIC
DCX	152	236	7.17e-35	SMART
low complexity region	343	354	N/A	INTRINSIC
low complexity region	403	414	N/A	INTRINSIC
low complexity region	462	473	N/A	INTRINSIC
low complexity region	646	661	N/A	INTRINSIC
low complexity region	1113	1123	N/A	INTRINSIC
low complexity region	1396	1412	N/A	INTRINSIC
low complexity region	1434	1444	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194992

SMART Domains

Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

Domain	Start	End	E-Value	Type
DCX	40	127	4.37e-39	SMART
low complexity region	130	143	N/A	INTRINSIC
DCX	162	246	7.17e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000208660

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208793

Meta Mutation Damage Score

0.0895

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,262,938	S3012P	unknown	Het
Abcb10	C	T	8: 123,982,690	A42T	probably benign	Het
Acsf3	T	C	8: 122,817,436	V551A	probably damaging	Het
Adgrl2	G	A	3: 148,859,020	T304I	probably damaging	Het
Akr1d1	A	G	6: 37,554,587		probably null	Het
Ankrd17	A	T	5: 90,264,786	H1226Q	probably damaging	Het
Arap1	T	C	7: 101,398,791	I847T	probably damaging	Het
Atad2b	G	A	12: 4,943,251	G257S	probably benign	Het
Cand2	A	T	6: 115,801,948	T1158S	probably benign	Het
Cic	G	A	7: 25,272,902	R686H	probably damaging	Het
Cldn1	T	A	16: 26,363,163	T99S	probably benign	Het
Cnga3	G	T	1: 37,258,006	E173*	probably null	Het
Cryge	G	T	1: 65,051,052		probably benign	Het
Dsp	T	A	13: 38,192,469	L1410H	probably damaging	Het
Dync2h1	T	C	9: 7,134,364	T1548A	probably benign	Het
Dysf	C	A	6: 84,097,715	D499E	probably damaging	Het
Eml5	T	C	12: 98,790,619	D1917G	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam71d	A	G	12: 78,715,153	D197G	probably damaging	Het
Fn3krp	A	T	11: 121,425,053	H90L	possibly damaging	Het
Gm10718	A	T	9: 3,023,716	T56S	probably benign	Het
Gm4847	A	T	1: 166,642,339	I55K	probably damaging	Het
Gsn	T	A	2: 35,283,900		probably null	Het
Haghl	T	C	17: 25,783,006		probably benign	Het
Hist1h2bj	G	T	13: 22,043,251		probably benign	Het
Hmg20b	T	A	10: 81,346,927	E139V	probably damaging	Het
Hsd3b6	G	A	3: 98,807,905	T57I	probably benign	Het
Igkv5-48	A	G	6: 69,726,796	S42P	probably damaging	Het
Igsf23	T	C	7: 19,953,934		probably benign	Het
Kcnt1	T	C	2: 25,908,100	F874L	probably damaging	Het
Maf1	T	C	15: 76,352,962	F110L	possibly damaging	Het
Mtpap	C	T	18: 4,387,044	R365W	probably damaging	Het
Mtus1	A	C	8: 41,084,470	S70A	possibly damaging	Het
Nfatc1	T	A	18: 80,697,865	T307S	probably benign	Het
Nphs1	T	G	7: 30,463,232	S379A	possibly damaging	Het
Nup205	A	G	6: 35,230,530	T1506A	probably benign	Het
Olfr1044	T	A	2: 86,171,671	I49F	probably damaging	Het
Olfr275	T	C	4: 52,825,450	S18P	possibly damaging	Het
Pcdhga8	A	T	18: 37,727,709	Y606F	probably damaging	Het
Pde7a	A	G	3: 19,243,117	V123A	probably benign	Het
Pex1	C	T	5: 3,624,426	T809I	probably benign	Het
Prdm13	C	A	4: 21,678,243	R749L	possibly damaging	Het
Prkcd	A	G	14: 30,599,743	L498P	probably damaging	Het
Pros1	A	T	16: 62,885,524	E67V	probably damaging	Het
Rab44	A	G	17: 29,140,089	E417G	possibly damaging	Het
Rangrf	A	G	11: 68,973,640		probably null	Het
Ryr2	A	T	13: 11,668,820	D3119E	probably damaging	Het
Ryr2	G	A	13: 11,745,752	R1482C	probably damaging	Het
Sbspon	T	A	1: 15,858,968	T200S	probably damaging	Het
Sfxn5	T	C	6: 85,332,376		probably benign	Het
Slc26a8	T	A	17: 28,654,883	I377F	probably benign	Het
Slc30a7	A	G	3: 115,993,008	F72L	probably damaging	Het
Slc32a1	T	C	2: 158,614,192	F256L	possibly damaging	Het
Slco6b1	T	C	1: 96,911,833		noncoding transcript	Het
Smpd1	A	G	7: 105,555,985	H357R	probably benign	Het
Sncaip	A	T	18: 52,871,384	H361L	probably damaging	Het
Tenm2	A	C	11: 36,023,488	Y2406*	probably null	Het
Terb1	T	A	8: 104,485,425	H308L	probably benign	Het
Trim61	A	T	8: 65,013,418	L397H	probably damaging	Het
Trp53bp1	T	A	2: 121,205,113		probably null	Het
Ttn	T	G	2: 76,781,555	E9007D	possibly damaging	Het
Urb1	A	T	16: 90,795,414	C319*	probably null	Het
Vmn2r95	T	C	17: 18,451,653	Y551H	probably damaging	Het
Vwde	A	T	6: 13,196,048	V326D	possibly damaging	Het
Xdh	A	G	17: 73,898,335	L1045P	probably damaging	Het
Zfp638	T	C	6: 83,979,475	I1688T	possibly damaging	Het
Zwint	T	A	10: 72,655,956		probably benign	Het

Other mutations in Rp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Rp1	APN	1	4346746	missense	probably damaging	0.98
IGL00593:Rp1	APN	1	4345403	missense	possibly damaging	0.70
IGL00956:Rp1	APN	1	4352212	missense	probably damaging	1.00
IGL01070:Rp1	APN	1	4345238	missense	probably damaging	1.00
IGL01531:Rp1	APN	1	4348945	missense	probably benign	0.00
IGL01668:Rp1	APN	1	4345718	missense	probably damaging	1.00
IGL01907:Rp1	APN	1	4348507	missense	possibly damaging	0.56
IGL02055:Rp1	APN	1	4352522	missense	probably damaging	1.00
IGL02071:Rp1	APN	1	4345310	missense	possibly damaging	0.46
IGL02128:Rp1	APN	1	4347385	missense	probably damaging	0.99
IGL02244:Rp1	APN	1	4348780	missense	probably benign	0.00
IGL02381:Rp1	APN	1	4352390	missense	probably benign	0.01
IGL02499:Rp1	APN	1	4349048	missense	probably benign	0.17
IGL02619:Rp1	APN	1	4348450	missense	possibly damaging	0.73
IGL02832:Rp1	APN	1	4349713	missense	probably benign	0.03
IGL02861:Rp1	APN	1	4346152	nonsense	probably null
IGL03288:Rp1	APN	1	4349524	missense	possibly damaging	0.88
IGL03290:Rp1	APN	1	4350041	missense	probably damaging	1.00
IGL03303:Rp1	APN	1	4344817	missense	probably damaging	1.00
R0041:Rp1	UTSW	1	4344628	missense	probably benign	0.36
R0111:Rp1	UTSW	1	4344760	missense	probably damaging	1.00
R0363:Rp1	UTSW	1	4347718	missense	probably damaging	1.00
R0440:Rp1	UTSW	1	4345640	missense	probably damaging	1.00
R0442:Rp1	UTSW	1	4346747	missense	probably benign	0.09
R0528:Rp1	UTSW	1	4344865	missense	possibly damaging	0.82
R0586:Rp1	UTSW	1	4347837	missense	possibly damaging	0.76
R0639:Rp1	UTSW	1	4346498	missense	probably benign	0.00
R0856:Rp1	UTSW	1	4344655	missense	probably benign	0.05
R0908:Rp1	UTSW	1	4344655	missense	probably benign	0.05
R0968:Rp1	UTSW	1	4345352	missense	probably benign	0.00
R1099:Rp1	UTSW	1	4352290	missense	possibly damaging	0.45
R1242:Rp1	UTSW	1	4344962	missense	probably benign	0.03
R1301:Rp1	UTSW	1	4345936	missense	possibly damaging	0.56
R1327:Rp1	UTSW	1	4347970	missense	probably benign	0.01
R1403:Rp1	UTSW	1	4346297	missense	possibly damaging	0.73
R1403:Rp1	UTSW	1	4346297	missense	possibly damaging	0.73
R1406:Rp1	UTSW	1	4351921	missense	possibly damaging	0.88
R1406:Rp1	UTSW	1	4351921	missense	possibly damaging	0.88
R1440:Rp1	UTSW	1	4347396	missense	probably damaging	1.00
R1509:Rp1	UTSW	1	4347694	missense	probably damaging	0.98
R1509:Rp1	UTSW	1	4348537	missense	probably benign	0.20
R1538:Rp1	UTSW	1	4345676	missense	probably damaging	1.00
R1609:Rp1	UTSW	1	4349201	missense	probably damaging	1.00
R1666:Rp1	UTSW	1	4349863	missense	probably damaging	1.00
R1703:Rp1	UTSW	1	4345169	missense	probably damaging	1.00
R1782:Rp1	UTSW	1	4349089	missense	probably benign	0.00
R1799:Rp1	UTSW	1	4348832	missense	possibly damaging	0.94
R1848:Rp1	UTSW	1	4347232	missense	possibly damaging	0.76
R1908:Rp1	UTSW	1	4348720	missense	probably damaging	0.99
R1919:Rp1	UTSW	1	4352671	missense	probably damaging	0.99
R2087:Rp1	UTSW	1	4348352	missense	probably damaging	1.00
R2211:Rp1	UTSW	1	4348139	missense	probably damaging	0.96
R2278:Rp1	UTSW	1	4348027	missense	possibly damaging	0.51
R2287:Rp1	UTSW	1	4345959	nonsense	probably null
R2316:Rp1	UTSW	1	4345640	missense	probably damaging	1.00
R2346:Rp1	UTSW	1	4348013	missense	probably damaging	1.00
R2878:Rp1	UTSW	1	4348139	missense	probably damaging	1.00
R3023:Rp1	UTSW	1	4352675	missense	probably damaging	1.00
R3025:Rp1	UTSW	1	4352675	missense	probably damaging	1.00
R3716:Rp1	UTSW	1	4349765	missense	probably benign	0.38
R3814:Rp1	UTSW	1	4349708	missense	probably benign
R3929:Rp1	UTSW	1	4352645	missense	probably damaging	1.00
R4064:Rp1	UTSW	1	4345400	missense	probably benign	0.08
R4426:Rp1	UTSW	1	4347924	missense	probably benign	0.13
R4557:Rp1	UTSW	1	4344663	missense	possibly damaging	0.61
R4764:Rp1	UTSW	1	4345878	missense	probably damaging	0.96
R4845:Rp1	UTSW	1	4349228	missense	probably benign	0.02
R4857:Rp1	UTSW	1	4352316	missense	probably damaging	0.99
R4857:Rp1	UTSW	1	4352317	missense	probably damaging	1.00
R5159:Rp1	UTSW	1	4346203	missense	possibly damaging	0.73
R5226:Rp1	UTSW	1	4348033	missense	probably benign	0.01
R5327:Rp1	UTSW	1	4349360	splice site	probably null
R5352:Rp1	UTSW	1	4347098	missense	probably benign	0.00
R5504:Rp1	UTSW	1	4349890	missense	probably damaging	1.00
R5527:Rp1	UTSW	1	4346393	missense	possibly damaging	0.75
R5529:Rp1	UTSW	1	4345832	missense	probably benign	0.42
R5569:Rp1	UTSW	1	4345237	missense	probably damaging	1.00
R5622:Rp1	UTSW	1	4347837	missense	possibly damaging	0.76
R5970:Rp1	UTSW	1	4348462	missense	probably benign	0.05
R5992:Rp1	UTSW	1	4148703	missense	unknown
R6004:Rp1	UTSW	1	4197585	missense	unknown
R6018:Rp1	UTSW	1	4352836	missense	possibly damaging	0.83
R6074:Rp1	UTSW	1	4345379	missense	probably benign	0.02
R6127:Rp1	UTSW	1	4349311	missense	possibly damaging	0.80
R6187:Rp1	UTSW	1	4349869	missense	probably damaging	1.00
R6301:Rp1	UTSW	1	4347254	missense	probably benign	0.04
R6317:Rp1	UTSW	1	4041989	missense	unknown
R6405:Rp1	UTSW	1	4345771	missense	probably damaging	1.00
R6445:Rp1	UTSW	1	4226617	missense	unknown
R6466:Rp1	UTSW	1	4347886	missense	probably benign	0.01
R6501:Rp1	UTSW	1	4311280	intron	probably benign
R6547:Rp1	UTSW	1	4170305	missense	unknown
R6604:Rp1	UTSW	1	4019128	missense	unknown
R6700:Rp1	UTSW	1	4349896	missense	probably damaging	1.00
R6706:Rp1	UTSW	1	4142664	missense	unknown
R6831:Rp1	UTSW	1	4349864	splice site	probably null
R6918:Rp1	UTSW	1	3999608	missense	unknown
R6973:Rp1	UTSW	1	4351994	nonsense	probably null
R6981:Rp1	UTSW	1	4345655	missense	probably benign	0.06
R7009:Rp1	UTSW	1	4042068	missense	unknown
R7078:Rp1	UTSW	1	4206791	missense	unknown
R7112:Rp1	UTSW	1	4349018	missense	probably benign	0.43
R7135:Rp1	UTSW	1	4348168	missense	possibly damaging	0.83
R7165:Rp1	UTSW	1	4349917	missense	probably damaging	0.99
R7199:Rp1	UTSW	1	4347290	missense	possibly damaging	0.73
R7232:Rp1	UTSW	1	4228601	missense	unknown
R7367:Rp1	UTSW	1	4347998	missense	probably benign	0.42
R7484:Rp1	UTSW	1	4345481	missense	probably benign	0.10
R7500:Rp1	UTSW	1	4311278	missense	unknown
R7569:Rp1	UTSW	1	4284840	missense	unknown
R7642:Rp1	UTSW	1	4147831	missense	unknown
R7693:Rp1	UTSW	1	4347403	missense	probably damaging	1.00
R7742:Rp1	UTSW	1	4170234	missense	unknown
R7759:Rp1	UTSW	1	4344884	missense	probably benign
R7784:Rp1	UTSW	1	4142658	missense	unknown
R7816:Rp1	UTSW	1	4347703	missense	probably damaging	0.98
R7866:Rp1	UTSW	1	4347701	missense	probably benign	0.02
R8215:Rp1	UTSW	1	4245095	missense	unknown
R8281:Rp1	UTSW	1	4347916	missense	probably damaging	1.00
R8294:Rp1	UTSW	1	4345997	missense	probably benign	0.09
R8309:Rp1	UTSW	1	4347089	missense	probably benign	0.00
R8311:Rp1	UTSW	1	4348349	missense	probably benign	0.11
R8500:Rp1	UTSW	1	4346590	missense	possibly damaging	0.91
R8559:Rp1	UTSW	1	4349561	missense	probably damaging	1.00
R8672:Rp1	UTSW	1	4348784	missense	possibly damaging	0.55
R8688:Rp1	UTSW	1	4346405	missense	probably benign	0.01
R8792:Rp1	UTSW	1	4024868	missense	unknown
R8859:Rp1	UTSW	1	4349960	missense	probably benign	0.07
R8945:Rp1	UTSW	1	4349594	missense	probably benign	0.42
R8959:Rp1	UTSW	1	4349427	intron	probably benign
R8979:Rp1	UTSW	1	4148714	missense	unknown
R9126:Rp1	UTSW	1	4346913	missense	probably damaging	0.99
R9156:Rp1	UTSW	1	4163938	missense	unknown
R9160:Rp1	UTSW	1	4346497	missense	probably benign	0.00
R9221:Rp1	UTSW	1	4245043	missense	unknown
R9263:Rp1	UTSW	1	4348452	missense	probably benign	0.25
R9263:Rp1	UTSW	1	4348937	missense	probably benign	0.02
R9302:Rp1	UTSW	1	4346566	missense	probably damaging	1.00
R9318:Rp1	UTSW	1	4348265	missense	probably benign	0.09
R9414:Rp1	UTSW	1	4243618	missense	unknown
R9474:Rp1	UTSW	1	4092615	critical splice donor site	probably null
R9478:Rp1	UTSW	1	4347322	missense	probably benign	0.06
R9529:Rp1	UTSW	1	4346224	missense	probably benign
R9572:Rp1	UTSW	1	4348439	missense	probably benign
R9673:Rp1	UTSW	1	4267569	missense	unknown
R9709:Rp1	UTSW	1	4042032	missense	unknown
R9716:Rp1	UTSW	1	4142610	critical splice donor site	probably null
RF003:Rp1	UTSW	1	4344694	missense	probably damaging	0.99
V1662:Rp1	UTSW	1	4349560	missense	probably damaging	1.00
X0012:Rp1	UTSW	1	4347695	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GACTTTCACAGAGTTTCGAGTCAC -3'
(R):5'- GCAGCGAATGATAACTTCCAATG -3'

Sequencing Primer
(F):5'- CACAGAGTTTCGAGTCACTATGG -3'
(R):5'- GTGATTGAAACCAAAGGACCC -3'

Posted On

2016-03-01