Incidental Mutation 'R4850:Kcnt1'
ID 373442
Institutional Source Beutler Lab
Gene Symbol Kcnt1
Ensembl Gene ENSMUSG00000058740
Gene Name potassium channel, subfamily T, member 1
Synonyms C030030G16Rik, Slack, slo2
MMRRC Submission 042462-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R4850 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 25753807-25808285 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25798112 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 874 (F874L)
Ref Sequence ENSEMBL: ENSMUSP00000143482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037580] [ENSMUST00000114172] [ENSMUST00000114176] [ENSMUST00000128502] [ENSMUST00000153001] [ENSMUST00000171268] [ENSMUST00000197917] [ENSMUST00000198204] [ENSMUST00000200434]
AlphaFold Q6ZPR4
Predicted Effect probably damaging
Transcript: ENSMUST00000037580
AA Change: F910L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039058
Gene: ENSMUSG00000058740
AA Change: F910L

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 252 335 1.3e-12 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 477 579 5.8e-32 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1212 1229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114172
AA Change: F896L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109809
Gene: ENSMUSG00000058740
AA Change: F896L

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114176
AA Change: F910L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109813
Gene: ENSMUSG00000058740
AA Change: F910L

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.1e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.2e-38 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145544
Predicted Effect probably damaging
Transcript: ENSMUST00000153001
AA Change: F218L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142532
Gene: ENSMUSG00000058740
AA Change: F218L

DomainStartEndE-ValueType
PDB:4HPF|B 79 285 6e-9 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000171268
AA Change: F890L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132212
Gene: ENSMUSG00000058740
AA Change: F890L

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Ion_trans_2 235 315 5.1e-13 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Pfam:BK_channel_a 455 560 3.2e-38 PFAM
PDB:3U6N|H 774 963 7e-6 PDB
low complexity region 1039 1056 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197917
AA Change: F908L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143106
Gene: ENSMUSG00000058740
AA Change: F908L

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198204
AA Change: F876L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142870
Gene: ENSMUSG00000058740
AA Change: F876L

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.2e-35 PFAM
PDB:3U6N|H 760 949 6e-6 PDB
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200434
AA Change: F874L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143482
Gene: ENSMUSG00000058740
AA Change: F874L

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5.1e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.3e-35 PFAM
PDB:3U6N|H 758 947 6e-6 PDB
low complexity region 1023 1040 N/A INTRINSIC
low complexity region 1176 1193 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199269
Meta Mutation Damage Score 0.5269 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: This gene encodes a member of the Slo potassium channel family that has shown to be activated by both sodium and chloride ions. This channel represents the largest potassium channel subunit yet identified. This channel may be important in development and pain signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired action potential firing in sensory neurons and increased mechanical hypersensitivity in neuropathic pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 124,709,429 (GRCm39) A42T probably benign Het
Acsf3 T C 8: 123,544,175 (GRCm39) V551A probably damaging Het
Adgrl2 G A 3: 148,564,656 (GRCm39) T304I probably damaging Het
Akr1d1 A G 6: 37,531,522 (GRCm39) probably null Het
Ankrd17 A T 5: 90,412,645 (GRCm39) H1226Q probably damaging Het
Arap1 T C 7: 101,047,998 (GRCm39) I847T probably damaging Het
Atad2b G A 12: 4,993,251 (GRCm39) G257S probably benign Het
Cand2 A T 6: 115,778,909 (GRCm39) T1158S probably benign Het
Cic G A 7: 24,972,327 (GRCm39) R686H probably damaging Het
Cldn1 T A 16: 26,181,913 (GRCm39) T99S probably benign Het
Cnga3 G T 1: 37,297,087 (GRCm39) E173* probably null Het
Cplane1 T C 15: 8,292,422 (GRCm39) S3012P unknown Het
Cryge G T 1: 65,090,211 (GRCm39) probably benign Het
Dsp T A 13: 38,376,445 (GRCm39) L1410H probably damaging Het
Dync2h1 T C 9: 7,134,364 (GRCm39) T1548A probably benign Het
Dysf C A 6: 84,074,697 (GRCm39) D499E probably damaging Het
Eml5 T C 12: 98,756,878 (GRCm39) D1917G probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fn3krp A T 11: 121,315,879 (GRCm39) H90L possibly damaging Het
Garin2 A G 12: 78,761,927 (GRCm39) D197G probably damaging Het
Gm10718 A T 9: 3,023,716 (GRCm39) T56S probably benign Het
Gm4847 A T 1: 166,469,908 (GRCm39) I55K probably damaging Het
Gsn T A 2: 35,173,912 (GRCm39) probably null Het
H2bc11 G T 13: 22,227,421 (GRCm39) probably benign Het
Haghl T C 17: 26,001,980 (GRCm39) probably benign Het
Hmg20b T A 10: 81,182,761 (GRCm39) E139V probably damaging Het
Hsd3b6 G A 3: 98,715,221 (GRCm39) T57I probably benign Het
Igkv5-48 A G 6: 69,703,780 (GRCm39) S42P probably damaging Het
Igsf23 T C 7: 19,687,859 (GRCm39) probably benign Het
Maf1 T C 15: 76,237,162 (GRCm39) F110L possibly damaging Het
Mtpap C T 18: 4,387,044 (GRCm39) R365W probably damaging Het
Mtus1 A C 8: 41,537,507 (GRCm39) S70A possibly damaging Het
Nfatc1 T A 18: 80,741,080 (GRCm39) T307S probably benign Het
Nphs1 T G 7: 30,162,657 (GRCm39) S379A possibly damaging Het
Nup205 A G 6: 35,207,465 (GRCm39) T1506A probably benign Het
Or13f5 T C 4: 52,825,450 (GRCm39) S18P possibly damaging Het
Or8u9 T A 2: 86,002,015 (GRCm39) I49F probably damaging Het
Pcdhga8 A T 18: 37,860,762 (GRCm39) Y606F probably damaging Het
Pde7a A G 3: 19,297,281 (GRCm39) V123A probably benign Het
Pex1 C T 5: 3,674,426 (GRCm39) T809I probably benign Het
Prdm13 C A 4: 21,678,243 (GRCm39) R749L possibly damaging Het
Prkcd A G 14: 30,321,700 (GRCm39) L498P probably damaging Het
Pros1 A T 16: 62,705,887 (GRCm39) E67V probably damaging Het
Rab44 A G 17: 29,359,063 (GRCm39) E417G possibly damaging Het
Rangrf A G 11: 68,864,466 (GRCm39) probably null Het
Rp1 T A 1: 4,418,898 (GRCm39) K738M probably damaging Het
Ryr2 A T 13: 11,683,706 (GRCm39) D3119E probably damaging Het
Ryr2 G A 13: 11,760,638 (GRCm39) R1482C probably damaging Het
Sbspon T A 1: 15,929,192 (GRCm39) T200S probably damaging Het
Sfxn5 T C 6: 85,309,358 (GRCm39) probably benign Het
Slc26a8 T A 17: 28,873,857 (GRCm39) I377F probably benign Het
Slc30a7 A G 3: 115,786,657 (GRCm39) F72L probably damaging Het
Slc32a1 T C 2: 158,456,112 (GRCm39) F256L possibly damaging Het
Slco6b1 T C 1: 96,839,558 (GRCm39) noncoding transcript Het
Smpd1 A G 7: 105,205,192 (GRCm39) H357R probably benign Het
Sncaip A T 18: 53,004,456 (GRCm39) H361L probably damaging Het
Tenm2 A C 11: 35,914,315 (GRCm39) Y2406* probably null Het
Terb1 T A 8: 105,212,057 (GRCm39) H308L probably benign Het
Trim61 A T 8: 65,466,070 (GRCm39) L397H probably damaging Het
Trp53bp1 T A 2: 121,035,594 (GRCm39) probably null Het
Ttn T G 2: 76,611,899 (GRCm39) E9007D possibly damaging Het
Urb1 A T 16: 90,592,302 (GRCm39) C319* probably null Het
Vmn2r95 T C 17: 18,671,915 (GRCm39) Y551H probably damaging Het
Vwde A T 6: 13,196,047 (GRCm39) V326D possibly damaging Het
Xdh A G 17: 74,205,330 (GRCm39) L1045P probably damaging Het
Zfp638 T C 6: 83,956,457 (GRCm39) I1688T possibly damaging Het
Zwint T A 10: 72,491,788 (GRCm39) probably benign Het
Other mutations in Kcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Kcnt1 APN 2 25,782,419 (GRCm39) missense probably damaging 0.98
IGL01358:Kcnt1 APN 2 25,806,017 (GRCm39) missense probably damaging 1.00
IGL01593:Kcnt1 APN 2 25,788,766 (GRCm39) missense probably damaging 1.00
IGL01779:Kcnt1 APN 2 25,790,979 (GRCm39) missense probably damaging 1.00
IGL01800:Kcnt1 APN 2 25,778,137 (GRCm39) missense probably damaging 1.00
IGL01834:Kcnt1 APN 2 25,802,731 (GRCm39) critical splice donor site probably null
IGL02001:Kcnt1 APN 2 25,798,164 (GRCm39) missense probably damaging 1.00
IGL02061:Kcnt1 APN 2 25,790,494 (GRCm39) critical splice donor site probably null
IGL02121:Kcnt1 APN 2 25,791,877 (GRCm39) missense probably damaging 1.00
IGL02646:Kcnt1 APN 2 25,790,892 (GRCm39) splice site probably benign
IGL02683:Kcnt1 APN 2 25,790,937 (GRCm39) missense possibly damaging 0.85
IGL03028:Kcnt1 APN 2 25,799,215 (GRCm39) critical splice acceptor site probably null
IGL03139:Kcnt1 APN 2 25,784,480 (GRCm39) splice site probably benign
R0070:Kcnt1 UTSW 2 25,782,374 (GRCm39) missense probably benign 0.00
R0070:Kcnt1 UTSW 2 25,782,374 (GRCm39) missense probably benign 0.00
R0149:Kcnt1 UTSW 2 25,788,276 (GRCm39) splice site probably benign
R0294:Kcnt1 UTSW 2 25,778,122 (GRCm39) missense probably damaging 0.99
R0367:Kcnt1 UTSW 2 25,797,640 (GRCm39) missense probably damaging 1.00
R0481:Kcnt1 UTSW 2 25,782,508 (GRCm39) missense probably damaging 0.98
R0666:Kcnt1 UTSW 2 25,781,255 (GRCm39) splice site probably benign
R1364:Kcnt1 UTSW 2 25,798,106 (GRCm39) missense probably damaging 0.99
R1553:Kcnt1 UTSW 2 25,790,397 (GRCm39) missense probably damaging 1.00
R1916:Kcnt1 UTSW 2 25,790,481 (GRCm39) missense probably damaging 1.00
R1999:Kcnt1 UTSW 2 25,782,372 (GRCm39) missense probably benign
R2079:Kcnt1 UTSW 2 25,790,260 (GRCm39) missense possibly damaging 0.48
R2166:Kcnt1 UTSW 2 25,781,195 (GRCm39) splice site probably benign
R2295:Kcnt1 UTSW 2 25,790,933 (GRCm39) missense probably damaging 1.00
R3688:Kcnt1 UTSW 2 25,784,371 (GRCm39) missense probably damaging 1.00
R3820:Kcnt1 UTSW 2 25,790,904 (GRCm39) missense probably damaging 1.00
R3826:Kcnt1 UTSW 2 25,805,880 (GRCm39) critical splice donor site probably null
R3980:Kcnt1 UTSW 2 25,783,226 (GRCm39) missense possibly damaging 0.91
R4031:Kcnt1 UTSW 2 25,806,060 (GRCm39) missense possibly damaging 0.77
R4093:Kcnt1 UTSW 2 25,767,927 (GRCm39) missense probably damaging 0.99
R4361:Kcnt1 UTSW 2 25,768,044 (GRCm39) missense probably benign 0.03
R4367:Kcnt1 UTSW 2 25,797,638 (GRCm39) missense probably damaging 1.00
R5005:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably damaging 1.00
R5119:Kcnt1 UTSW 2 25,799,334 (GRCm39) intron probably benign
R5223:Kcnt1 UTSW 2 25,793,434 (GRCm39) missense probably benign
R5243:Kcnt1 UTSW 2 25,798,086 (GRCm39) missense probably damaging 1.00
R5323:Kcnt1 UTSW 2 25,799,289 (GRCm39) missense possibly damaging 0.59
R5665:Kcnt1 UTSW 2 25,791,921 (GRCm39) nonsense probably null
R5888:Kcnt1 UTSW 2 25,798,122 (GRCm39) missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25,788,413 (GRCm39) missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25,784,536 (GRCm39) intron probably benign
R5927:Kcnt1 UTSW 2 25,799,388 (GRCm39) intron probably benign
R6160:Kcnt1 UTSW 2 25,782,395 (GRCm39) missense probably damaging 0.96
R6161:Kcnt1 UTSW 2 25,793,397 (GRCm39) missense probably benign 0.00
R6179:Kcnt1 UTSW 2 25,783,192 (GRCm39) missense probably damaging 1.00
R6222:Kcnt1 UTSW 2 25,782,522 (GRCm39) missense probably damaging 1.00
R6268:Kcnt1 UTSW 2 25,793,609 (GRCm39) splice site probably null
R6336:Kcnt1 UTSW 2 25,778,767 (GRCm39) splice site probably null
R6395:Kcnt1 UTSW 2 25,799,251 (GRCm39) missense possibly damaging 0.81
R6564:Kcnt1 UTSW 2 25,801,063 (GRCm39) missense probably benign 0.09
R6944:Kcnt1 UTSW 2 25,767,840 (GRCm39) intron probably benign
R7236:Kcnt1 UTSW 2 25,799,951 (GRCm39) splice site probably null
R7308:Kcnt1 UTSW 2 25,790,475 (GRCm39) missense possibly damaging 0.74
R7346:Kcnt1 UTSW 2 25,753,855 (GRCm39) unclassified probably benign
R7419:Kcnt1 UTSW 2 25,806,011 (GRCm39) missense probably benign 0.11
R7461:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably benign 0.01
R7470:Kcnt1 UTSW 2 25,799,845 (GRCm39) missense probably damaging 0.96
R7566:Kcnt1 UTSW 2 25,806,048 (GRCm39) missense probably benign 0.31
R7613:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably benign 0.01
R7778:Kcnt1 UTSW 2 25,791,901 (GRCm39) missense probably benign 0.10
R8031:Kcnt1 UTSW 2 25,798,054 (GRCm39) splice site probably benign
R8088:Kcnt1 UTSW 2 25,784,326 (GRCm39) missense possibly damaging 0.63
R8113:Kcnt1 UTSW 2 25,791,223 (GRCm39) missense possibly damaging 0.67
R8378:Kcnt1 UTSW 2 25,797,283 (GRCm39) missense probably benign 0.03
R8954:Kcnt1 UTSW 2 25,784,338 (GRCm39) missense probably benign
R9231:Kcnt1 UTSW 2 25,801,074 (GRCm39) missense probably benign 0.00
R9445:Kcnt1 UTSW 2 25,767,959 (GRCm39) missense probably damaging 1.00
R9733:Kcnt1 UTSW 2 25,797,351 (GRCm39) missense probably benign 0.00
Z1176:Kcnt1 UTSW 2 25,796,808 (GRCm39) missense probably benign 0.07
Z1177:Kcnt1 UTSW 2 25,799,277 (GRCm39) nonsense probably null
Z1177:Kcnt1 UTSW 2 25,791,240 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTATGACCACAGGATCCACC -3'
(R):5'- ATCTGTTAGCAGTTCCTGGCG -3'

Sequencing Primer
(F):5'- TTATGACCACAGGATCCACCATAGAC -3'
(R):5'- TTAGCAGTTCCTGGCGGATCC -3'
Posted On 2016-03-01