Incidental Mutation 'R4850:Olfr1044'
ID373445
Institutional Source Beutler Lab
Gene Symbol Olfr1044
Ensembl Gene ENSMUSG00000075200
Gene Nameolfactory receptor 1044
SynonymsMOR185-4, GA_x6K02T2Q125-47640742-47639798
MMRRC Submission 042462-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4850 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86168589-86177820 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86171671 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 49 (I49F)
Ref Sequence ENSEMBL: ENSMUSP00000150199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099906] [ENSMUST00000213886] [ENSMUST00000213949] [ENSMUST00000215171] [ENSMUST00000216028]
Predicted Effect probably damaging
Transcript: ENSMUST00000099906
AA Change: I49F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097490
Gene: ENSMUSG00000075200
AA Change: I49F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.7e-59 PFAM
Pfam:7tm_1 41 290 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213886
Predicted Effect probably benign
Transcript: ENSMUST00000213949
Predicted Effect probably damaging
Transcript: ENSMUST00000215171
AA Change: I49F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215739
Predicted Effect probably benign
Transcript: ENSMUST00000216028
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcb10 C T 8: 123,982,690 A42T probably benign Het
Acsf3 T C 8: 122,817,436 V551A probably damaging Het
Adgrl2 G A 3: 148,859,020 T304I probably damaging Het
Akr1d1 A G 6: 37,554,587 probably null Het
Ankrd17 A T 5: 90,264,786 H1226Q probably damaging Het
Arap1 T C 7: 101,398,791 I847T probably damaging Het
Atad2b G A 12: 4,943,251 G257S probably benign Het
Cand2 A T 6: 115,801,948 T1158S probably benign Het
Cic G A 7: 25,272,902 R686H probably damaging Het
Cldn1 T A 16: 26,363,163 T99S probably benign Het
Cnga3 G T 1: 37,258,006 E173* probably null Het
Cryge G T 1: 65,051,052 probably benign Het
Dsp T A 13: 38,192,469 L1410H probably damaging Het
Dync2h1 T C 9: 7,134,364 T1548A probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eml5 T C 12: 98,790,619 D1917G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam71d A G 12: 78,715,153 D197G probably damaging Het
Fn3krp A T 11: 121,425,053 H90L possibly damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm4847 A T 1: 166,642,339 I55K probably damaging Het
Gsn T A 2: 35,283,900 probably null Het
Haghl T C 17: 25,783,006 probably benign Het
Hist1h2bj G T 13: 22,043,251 probably benign Het
Hmg20b T A 10: 81,346,927 E139V probably damaging Het
Hsd3b6 G A 3: 98,807,905 T57I probably benign Het
Igkv5-48 A G 6: 69,726,796 S42P probably damaging Het
Igsf23 T C 7: 19,953,934 probably benign Het
Kcnt1 T C 2: 25,908,100 F874L probably damaging Het
Maf1 T C 15: 76,352,962 F110L possibly damaging Het
Mtpap C T 18: 4,387,044 R365W probably damaging Het
Mtus1 A C 8: 41,084,470 S70A possibly damaging Het
Nfatc1 T A 18: 80,697,865 T307S probably benign Het
Nphs1 T G 7: 30,463,232 S379A possibly damaging Het
Nup205 A G 6: 35,230,530 T1506A probably benign Het
Olfr275 T C 4: 52,825,450 S18P possibly damaging Het
Pcdhga8 A T 18: 37,727,709 Y606F probably damaging Het
Pde7a A G 3: 19,243,117 V123A probably benign Het
Pex1 C T 5: 3,624,426 T809I probably benign Het
Prdm13 C A 4: 21,678,243 R749L possibly damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Pros1 A T 16: 62,885,524 E67V probably damaging Het
Rab44 A G 17: 29,140,089 E417G possibly damaging Het
Rangrf A G 11: 68,973,640 probably null Het
Rp1 T A 1: 4,348,675 K738M probably damaging Het
Ryr2 A T 13: 11,668,820 D3119E probably damaging Het
Ryr2 G A 13: 11,745,752 R1482C probably damaging Het
Sbspon T A 1: 15,858,968 T200S probably damaging Het
Sfxn5 T C 6: 85,332,376 probably benign Het
Slc26a8 T A 17: 28,654,883 I377F probably benign Het
Slc30a7 A G 3: 115,993,008 F72L probably damaging Het
Slc32a1 T C 2: 158,614,192 F256L possibly damaging Het
Slco6b1 T C 1: 96,911,833 noncoding transcript Het
Smpd1 A G 7: 105,555,985 H357R probably benign Het
Sncaip A T 18: 52,871,384 H361L probably damaging Het
Tenm2 A C 11: 36,023,488 Y2406* probably null Het
Terb1 T A 8: 104,485,425 H308L probably benign Het
Trim61 A T 8: 65,013,418 L397H probably damaging Het
Trp53bp1 T A 2: 121,205,113 probably null Het
Ttn T G 2: 76,781,555 E9007D possibly damaging Het
Urb1 A T 16: 90,795,414 C319* probably null Het
Vmn2r95 T C 17: 18,451,653 Y551H probably damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Xdh A G 17: 73,898,335 L1045P probably damaging Het
Zfp638 T C 6: 83,979,475 I1688T possibly damaging Het
Zwint T A 10: 72,655,956 probably benign Het
Other mutations in Olfr1044
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Olfr1044 APN 2 86171397 missense possibly damaging 0.90
IGL02562:Olfr1044 APN 2 86171040 missense probably damaging 1.00
R0230:Olfr1044 UTSW 2 86171542 missense probably benign 0.22
R0306:Olfr1044 UTSW 2 86171716 missense possibly damaging 0.80
R0373:Olfr1044 UTSW 2 86171706 missense probably damaging 0.98
R0539:Olfr1044 UTSW 2 86171043 missense probably damaging 0.98
R1925:Olfr1044 UTSW 2 86171010 missense probably benign 0.22
R2367:Olfr1044 UTSW 2 86171637 missense probably damaging 1.00
R4114:Olfr1044 UTSW 2 86171415 missense possibly damaging 0.90
R4851:Olfr1044 UTSW 2 86171671 missense probably damaging 1.00
R7402:Olfr1044 UTSW 2 86171202 missense probably benign 0.34
R7439:Olfr1044 UTSW 2 86171010 missense probably damaging 1.00
R7441:Olfr1044 UTSW 2 86171010 missense probably damaging 1.00
R7624:Olfr1044 UTSW 2 86171220 missense possibly damaging 0.95
R8096:Olfr1044 UTSW 2 86171712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCATAAAGGCTAGGAAACAGC -3'
(R):5'- ATTTGATGGACAAGCTTTGAGC -3'

Sequencing Primer
(F):5'- GCCTAACTGAGCAGCACATG -3'
(R):5'- CATGTTAACAGTGTAATGTGTTTCAC -3'
Posted On2016-03-01