Mutagenetix > Incidental Mutation

Incidental Mutation 'R4850:Nphs1'

373467

Institutional Source

Beutler Lab

Gene Symbol

Nphs1

Ensembl Gene

ENSMUSG00000006649

Gene Name

nephrosis 1, nephrin

Synonyms

nephrin

MMRRC Submission

042462-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4850 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30458315-30487223 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 30463232 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 379 (S379A)

Ref Sequence

ENSEMBL: ENSMUSP00000006825 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]

AlphaFold

Q9QZS7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006825
AA Change: S379A

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: S379A

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
IG	52	146	1.38e-6	SMART
Pfam:C2-set_2	152	242	4.1e-20	PFAM
IG	264	351	9.86e-3	SMART
IG_like	360	452	2.73e1	SMART
IG	464	556	2.99e-2	SMART
IG_like	572	644	8.9e-1	SMART
IG	667	751	1.32e-3	SMART
IG	760	849	7.3e-6	SMART
IGc2	868	941	5.4e-9	SMART
FN3	955	1036	1.01e-11	SMART
transmembrane domain	1078	1100	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000126297
AA Change: S365A

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: S365A

Domain	Start	End	E-Value	Type
IG	38	132	1.38e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152625

Meta Mutation Damage Score

0.1112

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,262,938	S3012P	unknown	Het
Abcb10	C	T	8: 123,982,690	A42T	probably benign	Het
Acsf3	T	C	8: 122,817,436	V551A	probably damaging	Het
Adgrl2	G	A	3: 148,859,020	T304I	probably damaging	Het
Akr1d1	A	G	6: 37,554,587		probably null	Het
Ankrd17	A	T	5: 90,264,786	H1226Q	probably damaging	Het
Arap1	T	C	7: 101,398,791	I847T	probably damaging	Het
Atad2b	G	A	12: 4,943,251	G257S	probably benign	Het
Cand2	A	T	6: 115,801,948	T1158S	probably benign	Het
Cic	G	A	7: 25,272,902	R686H	probably damaging	Het
Cldn1	T	A	16: 26,363,163	T99S	probably benign	Het
Cnga3	G	T	1: 37,258,006	E173*	probably null	Het
Cryge	G	T	1: 65,051,052		probably benign	Het
Dsp	T	A	13: 38,192,469	L1410H	probably damaging	Het
Dync2h1	T	C	9: 7,134,364	T1548A	probably benign	Het
Dysf	C	A	6: 84,097,715	D499E	probably damaging	Het
Eml5	T	C	12: 98,790,619	D1917G	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam71d	A	G	12: 78,715,153	D197G	probably damaging	Het
Fn3krp	A	T	11: 121,425,053	H90L	possibly damaging	Het
Gm10718	A	T	9: 3,023,716	T56S	probably benign	Het
Gm4847	A	T	1: 166,642,339	I55K	probably damaging	Het
Gsn	T	A	2: 35,283,900		probably null	Het
Haghl	T	C	17: 25,783,006		probably benign	Het
Hist1h2bj	G	T	13: 22,043,251		probably benign	Het
Hmg20b	T	A	10: 81,346,927	E139V	probably damaging	Het
Hsd3b6	G	A	3: 98,807,905	T57I	probably benign	Het
Igkv5-48	A	G	6: 69,726,796	S42P	probably damaging	Het
Igsf23	T	C	7: 19,953,934		probably benign	Het
Kcnt1	T	C	2: 25,908,100	F874L	probably damaging	Het
Maf1	T	C	15: 76,352,962	F110L	possibly damaging	Het
Mtpap	C	T	18: 4,387,044	R365W	probably damaging	Het
Mtus1	A	C	8: 41,084,470	S70A	possibly damaging	Het
Nfatc1	T	A	18: 80,697,865	T307S	probably benign	Het
Nup205	A	G	6: 35,230,530	T1506A	probably benign	Het
Olfr1044	T	A	2: 86,171,671	I49F	probably damaging	Het
Olfr275	T	C	4: 52,825,450	S18P	possibly damaging	Het
Pcdhga8	A	T	18: 37,727,709	Y606F	probably damaging	Het
Pde7a	A	G	3: 19,243,117	V123A	probably benign	Het
Pex1	C	T	5: 3,624,426	T809I	probably benign	Het
Prdm13	C	A	4: 21,678,243	R749L	possibly damaging	Het
Prkcd	A	G	14: 30,599,743	L498P	probably damaging	Het
Pros1	A	T	16: 62,885,524	E67V	probably damaging	Het
Rab44	A	G	17: 29,140,089	E417G	possibly damaging	Het
Rangrf	A	G	11: 68,973,640		probably null	Het
Rp1	T	A	1: 4,348,675	K738M	probably damaging	Het
Ryr2	A	T	13: 11,668,820	D3119E	probably damaging	Het
Ryr2	G	A	13: 11,745,752	R1482C	probably damaging	Het
Sbspon	T	A	1: 15,858,968	T200S	probably damaging	Het
Sfxn5	T	C	6: 85,332,376		probably benign	Het
Slc26a8	T	A	17: 28,654,883	I377F	probably benign	Het
Slc30a7	A	G	3: 115,993,008	F72L	probably damaging	Het
Slc32a1	T	C	2: 158,614,192	F256L	possibly damaging	Het
Slco6b1	T	C	1: 96,911,833		noncoding transcript	Het
Smpd1	A	G	7: 105,555,985	H357R	probably benign	Het
Sncaip	A	T	18: 52,871,384	H361L	probably damaging	Het
Tenm2	A	C	11: 36,023,488	Y2406*	probably null	Het
Terb1	T	A	8: 104,485,425	H308L	probably benign	Het
Trim61	A	T	8: 65,013,418	L397H	probably damaging	Het
Trp53bp1	T	A	2: 121,205,113		probably null	Het
Ttn	T	G	2: 76,781,555	E9007D	possibly damaging	Het
Urb1	A	T	16: 90,795,414	C319*	probably null	Het
Vmn2r95	T	C	17: 18,451,653	Y551H	probably damaging	Het
Vwde	A	T	6: 13,196,048	V326D	possibly damaging	Het
Xdh	A	G	17: 73,898,335	L1045P	probably damaging	Het
Zfp638	T	C	6: 83,979,475	I1688T	possibly damaging	Het
Zwint	T	A	10: 72,655,956		probably benign	Het

Other mutations in Nphs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Nphs1	APN	7	30482551	missense	possibly damaging	0.77
IGL00927:Nphs1	APN	7	30460739	unclassified	probably benign
IGL00976:Nphs1	APN	7	30460685	missense	possibly damaging	0.78
IGL01397:Nphs1	APN	7	30486664	missense	probably benign	0.01
IGL01465:Nphs1	APN	7	30486714	makesense	probably null
IGL01889:Nphs1	APN	7	30460511	missense	probably damaging	1.00
IGL02383:Nphs1	APN	7	30481635	splice site	probably benign
R0020:Nphs1	UTSW	7	30463208	missense	probably benign	0.01
R0485:Nphs1	UTSW	7	30467515	missense	probably benign
R1024:Nphs1	UTSW	7	30474277	missense	probably damaging	1.00
R1115:Nphs1	UTSW	7	30481378	splice site	probably benign
R1144:Nphs1	UTSW	7	30481678	splice site	probably benign
R1289:Nphs1	UTSW	7	30471178	missense	probably damaging	1.00
R1317:Nphs1	UTSW	7	30481831	splice site	probably benign
R1617:Nphs1	UTSW	7	30482531	missense	probably benign
R1756:Nphs1	UTSW	7	30461534	missense	probably benign	0.00
R1937:Nphs1	UTSW	7	30474373	missense	probably damaging	1.00
R2144:Nphs1	UTSW	7	30460970	missense	probably benign	0.13
R2256:Nphs1	UTSW	7	30467992	missense	possibly damaging	0.94
R2257:Nphs1	UTSW	7	30467992	missense	possibly damaging	0.94
R2277:Nphs1	UTSW	7	30467564	nonsense	probably null
R3104:Nphs1	UTSW	7	30467540	nonsense	probably null
R3106:Nphs1	UTSW	7	30467540	nonsense	probably null
R3151:Nphs1	UTSW	7	30460240	missense	probably benign
R3765:Nphs1	UTSW	7	30471210	missense	probably damaging	0.98
R4078:Nphs1	UTSW	7	30467520	nonsense	probably null
R4397:Nphs1	UTSW	7	30481965	splice site	probably null
R4635:Nphs1	UTSW	7	30468007	missense	probably benign	0.39
R4650:Nphs1	UTSW	7	30482470	missense	probably benign	0.21
R4811:Nphs1	UTSW	7	30460429	missense	probably damaging	1.00
R5272:Nphs1	UTSW	7	30481642	missense	possibly damaging	0.86
R5327:Nphs1	UTSW	7	30463825	missense	probably benign	0.00
R5681:Nphs1	UTSW	7	30486625	missense	probably benign	0.00
R5865:Nphs1	UTSW	7	30474385	missense	probably damaging	1.00
R5975:Nphs1	UTSW	7	30466115	missense	possibly damaging	0.82
R6186:Nphs1	UTSW	7	30465634	missense	probably damaging	0.98
R6198:Nphs1	UTSW	7	30467915	missense	probably damaging	0.97
R6353:Nphs1	UTSW	7	30474544	missense	probably damaging	0.99
R7405:Nphs1	UTSW	7	30462828	missense	possibly damaging	0.46
R7647:Nphs1	UTSW	7	30481965	splice site	probably null
R7767:Nphs1	UTSW	7	30463308	missense	probably damaging	1.00
R8132:Nphs1	UTSW	7	30482053	missense	probably benign	0.02
R8485:Nphs1	UTSW	7	30466173	missense	probably damaging	0.98
R8678:Nphs1	UTSW	7	30463859	missense	probably damaging	1.00
R8890:Nphs1	UTSW	7	30462655	missense	probably damaging	1.00
R8946:Nphs1	UTSW	7	30463200	missense	probably damaging	1.00
R9133:Nphs1	UTSW	7	30460667	nonsense	probably null
R9159:Nphs1	UTSW	7	30465601	missense	possibly damaging	0.93
R9347:Nphs1	UTSW	7	30471169	missense	probably damaging	1.00
R9547:Nphs1	UTSW	7	30481450	missense	probably benign	0.00
R9548:Nphs1	UTSW	7	30481450	missense	probably benign	0.00
R9607:Nphs1	UTSW	7	30463587	missense	probably damaging	1.00
R9626:Nphs1	UTSW	7	30467566	missense	probably benign	0.16
R9720:Nphs1	UTSW	7	30466074	missense	possibly damaging	0.83
R9733:Nphs1	UTSW	7	30467530	missense	probably damaging	1.00
X0028:Nphs1	UTSW	7	30467504	missense	probably null	0.01
Z1177:Nphs1	UTSW	7	30470903	missense	probably damaging	1.00
Z1186:Nphs1	UTSW	7	30460350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACCTCATTGTCAGCCTACC -3'
(R):5'- CAGATTTACGGCCCGAGAAG -3'

Sequencing Primer
(F):5'- GTTACCATCCTGGGATCT -3'
(R):5'- ACTCACGGTAGCAGAGGC -3'

Posted On

2016-03-01