Incidental Mutation 'R4850:Nphs1'
ID 373467
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
MMRRC Submission 042462-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4850 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 30157740-30186648 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 30162657 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 379 (S379A)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect possibly damaging
Transcript: ENSMUST00000006825
AA Change: S379A

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: S379A

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126297
AA Change: S365A

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: S365A

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152625
Meta Mutation Damage Score 0.1112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 124,709,429 (GRCm39) A42T probably benign Het
Acsf3 T C 8: 123,544,175 (GRCm39) V551A probably damaging Het
Adgrl2 G A 3: 148,564,656 (GRCm39) T304I probably damaging Het
Akr1d1 A G 6: 37,531,522 (GRCm39) probably null Het
Ankrd17 A T 5: 90,412,645 (GRCm39) H1226Q probably damaging Het
Arap1 T C 7: 101,047,998 (GRCm39) I847T probably damaging Het
Atad2b G A 12: 4,993,251 (GRCm39) G257S probably benign Het
Cand2 A T 6: 115,778,909 (GRCm39) T1158S probably benign Het
Cic G A 7: 24,972,327 (GRCm39) R686H probably damaging Het
Cldn1 T A 16: 26,181,913 (GRCm39) T99S probably benign Het
Cnga3 G T 1: 37,297,087 (GRCm39) E173* probably null Het
Cplane1 T C 15: 8,292,422 (GRCm39) S3012P unknown Het
Cryge G T 1: 65,090,211 (GRCm39) probably benign Het
Dsp T A 13: 38,376,445 (GRCm39) L1410H probably damaging Het
Dync2h1 T C 9: 7,134,364 (GRCm39) T1548A probably benign Het
Dysf C A 6: 84,074,697 (GRCm39) D499E probably damaging Het
Eml5 T C 12: 98,756,878 (GRCm39) D1917G probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fn3krp A T 11: 121,315,879 (GRCm39) H90L possibly damaging Het
Garin2 A G 12: 78,761,927 (GRCm39) D197G probably damaging Het
Gm10718 A T 9: 3,023,716 (GRCm39) T56S probably benign Het
Gm4847 A T 1: 166,469,908 (GRCm39) I55K probably damaging Het
Gsn T A 2: 35,173,912 (GRCm39) probably null Het
H2bc11 G T 13: 22,227,421 (GRCm39) probably benign Het
Haghl T C 17: 26,001,980 (GRCm39) probably benign Het
Hmg20b T A 10: 81,182,761 (GRCm39) E139V probably damaging Het
Hsd3b6 G A 3: 98,715,221 (GRCm39) T57I probably benign Het
Igkv5-48 A G 6: 69,703,780 (GRCm39) S42P probably damaging Het
Igsf23 T C 7: 19,687,859 (GRCm39) probably benign Het
Kcnt1 T C 2: 25,798,112 (GRCm39) F874L probably damaging Het
Maf1 T C 15: 76,237,162 (GRCm39) F110L possibly damaging Het
Mtpap C T 18: 4,387,044 (GRCm39) R365W probably damaging Het
Mtus1 A C 8: 41,537,507 (GRCm39) S70A possibly damaging Het
Nfatc1 T A 18: 80,741,080 (GRCm39) T307S probably benign Het
Nup205 A G 6: 35,207,465 (GRCm39) T1506A probably benign Het
Or13f5 T C 4: 52,825,450 (GRCm39) S18P possibly damaging Het
Or8u9 T A 2: 86,002,015 (GRCm39) I49F probably damaging Het
Pcdhga8 A T 18: 37,860,762 (GRCm39) Y606F probably damaging Het
Pde7a A G 3: 19,297,281 (GRCm39) V123A probably benign Het
Pex1 C T 5: 3,674,426 (GRCm39) T809I probably benign Het
Prdm13 C A 4: 21,678,243 (GRCm39) R749L possibly damaging Het
Prkcd A G 14: 30,321,700 (GRCm39) L498P probably damaging Het
Pros1 A T 16: 62,705,887 (GRCm39) E67V probably damaging Het
Rab44 A G 17: 29,359,063 (GRCm39) E417G possibly damaging Het
Rangrf A G 11: 68,864,466 (GRCm39) probably null Het
Rp1 T A 1: 4,418,898 (GRCm39) K738M probably damaging Het
Ryr2 A T 13: 11,683,706 (GRCm39) D3119E probably damaging Het
Ryr2 G A 13: 11,760,638 (GRCm39) R1482C probably damaging Het
Sbspon T A 1: 15,929,192 (GRCm39) T200S probably damaging Het
Sfxn5 T C 6: 85,309,358 (GRCm39) probably benign Het
Slc26a8 T A 17: 28,873,857 (GRCm39) I377F probably benign Het
Slc30a7 A G 3: 115,786,657 (GRCm39) F72L probably damaging Het
Slc32a1 T C 2: 158,456,112 (GRCm39) F256L possibly damaging Het
Slco6b1 T C 1: 96,839,558 (GRCm39) noncoding transcript Het
Smpd1 A G 7: 105,205,192 (GRCm39) H357R probably benign Het
Sncaip A T 18: 53,004,456 (GRCm39) H361L probably damaging Het
Tenm2 A C 11: 35,914,315 (GRCm39) Y2406* probably null Het
Terb1 T A 8: 105,212,057 (GRCm39) H308L probably benign Het
Trim61 A T 8: 65,466,070 (GRCm39) L397H probably damaging Het
Trp53bp1 T A 2: 121,035,594 (GRCm39) probably null Het
Ttn T G 2: 76,611,899 (GRCm39) E9007D possibly damaging Het
Urb1 A T 16: 90,592,302 (GRCm39) C319* probably null Het
Vmn2r95 T C 17: 18,671,915 (GRCm39) Y551H probably damaging Het
Vwde A T 6: 13,196,047 (GRCm39) V326D possibly damaging Het
Xdh A G 17: 74,205,330 (GRCm39) L1045P probably damaging Het
Zfp638 T C 6: 83,956,457 (GRCm39) I1688T possibly damaging Het
Zwint T A 10: 72,491,788 (GRCm39) probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30,181,976 (GRCm39) missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30,160,164 (GRCm39) unclassified probably benign
IGL00976:Nphs1 APN 7 30,160,110 (GRCm39) missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30,186,089 (GRCm39) missense probably benign 0.01
IGL01465:Nphs1 APN 7 30,186,139 (GRCm39) makesense probably null
IGL01889:Nphs1 APN 7 30,159,936 (GRCm39) missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30,181,060 (GRCm39) splice site probably benign
R0020:Nphs1 UTSW 7 30,162,633 (GRCm39) missense probably benign 0.01
R0485:Nphs1 UTSW 7 30,166,940 (GRCm39) missense probably benign
R1024:Nphs1 UTSW 7 30,173,702 (GRCm39) missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30,180,803 (GRCm39) splice site probably benign
R1144:Nphs1 UTSW 7 30,181,103 (GRCm39) splice site probably benign
R1289:Nphs1 UTSW 7 30,170,603 (GRCm39) missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30,181,256 (GRCm39) splice site probably benign
R1617:Nphs1 UTSW 7 30,181,956 (GRCm39) missense probably benign
R1756:Nphs1 UTSW 7 30,160,959 (GRCm39) missense probably benign 0.00
R1937:Nphs1 UTSW 7 30,173,798 (GRCm39) missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30,160,395 (GRCm39) missense probably benign 0.13
R2256:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30,166,989 (GRCm39) nonsense probably null
R3104:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3106:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3151:Nphs1 UTSW 7 30,159,665 (GRCm39) missense probably benign
R3765:Nphs1 UTSW 7 30,170,635 (GRCm39) missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30,166,945 (GRCm39) nonsense probably null
R4397:Nphs1 UTSW 7 30,181,390 (GRCm39) splice site probably null
R4635:Nphs1 UTSW 7 30,167,432 (GRCm39) missense probably benign 0.39
R4650:Nphs1 UTSW 7 30,181,895 (GRCm39) missense probably benign 0.21
R4811:Nphs1 UTSW 7 30,159,854 (GRCm39) missense probably damaging 1.00
R5272:Nphs1 UTSW 7 30,181,067 (GRCm39) missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30,163,250 (GRCm39) missense probably benign 0.00
R5681:Nphs1 UTSW 7 30,186,050 (GRCm39) missense probably benign 0.00
R5865:Nphs1 UTSW 7 30,173,810 (GRCm39) missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30,165,540 (GRCm39) missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30,165,059 (GRCm39) missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30,167,340 (GRCm39) missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30,173,969 (GRCm39) missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30,162,253 (GRCm39) missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30,181,390 (GRCm39) splice site probably null
R7767:Nphs1 UTSW 7 30,162,733 (GRCm39) missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30,181,478 (GRCm39) missense probably benign 0.02
R8485:Nphs1 UTSW 7 30,165,598 (GRCm39) missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30,163,284 (GRCm39) missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30,162,080 (GRCm39) missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30,162,625 (GRCm39) missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30,160,092 (GRCm39) nonsense probably null
R9159:Nphs1 UTSW 7 30,165,026 (GRCm39) missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30,170,594 (GRCm39) missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30,180,875 (GRCm39) missense probably benign 0.00
R9548:Nphs1 UTSW 7 30,180,875 (GRCm39) missense probably benign 0.00
R9607:Nphs1 UTSW 7 30,163,012 (GRCm39) missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30,166,991 (GRCm39) missense probably benign 0.16
R9720:Nphs1 UTSW 7 30,165,499 (GRCm39) missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30,166,955 (GRCm39) missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30,166,929 (GRCm39) missense probably null 0.01
Z1177:Nphs1 UTSW 7 30,170,328 (GRCm39) missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30,159,775 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCTCATTGTCAGCCTACC -3'
(R):5'- CAGATTTACGGCCCGAGAAG -3'

Sequencing Primer
(F):5'- GTTACCATCCTGGGATCT -3'
(R):5'- ACTCACGGTAGCAGAGGC -3'
Posted On 2016-03-01