Incidental Mutation 'R4850:Nphs1'
ID 373467
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
MMRRC Submission 042462-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4850 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 30463232 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 379 (S379A)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect possibly damaging
Transcript: ENSMUST00000006825
AA Change: S379A

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: S379A

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126297
AA Change: S365A

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: S365A

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152625
Meta Mutation Damage Score 0.1112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcb10 C T 8: 123,982,690 A42T probably benign Het
Acsf3 T C 8: 122,817,436 V551A probably damaging Het
Adgrl2 G A 3: 148,859,020 T304I probably damaging Het
Akr1d1 A G 6: 37,554,587 probably null Het
Ankrd17 A T 5: 90,264,786 H1226Q probably damaging Het
Arap1 T C 7: 101,398,791 I847T probably damaging Het
Atad2b G A 12: 4,943,251 G257S probably benign Het
Cand2 A T 6: 115,801,948 T1158S probably benign Het
Cic G A 7: 25,272,902 R686H probably damaging Het
Cldn1 T A 16: 26,363,163 T99S probably benign Het
Cnga3 G T 1: 37,258,006 E173* probably null Het
Cryge G T 1: 65,051,052 probably benign Het
Dsp T A 13: 38,192,469 L1410H probably damaging Het
Dync2h1 T C 9: 7,134,364 T1548A probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eml5 T C 12: 98,790,619 D1917G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam71d A G 12: 78,715,153 D197G probably damaging Het
Fn3krp A T 11: 121,425,053 H90L possibly damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm4847 A T 1: 166,642,339 I55K probably damaging Het
Gsn T A 2: 35,283,900 probably null Het
Haghl T C 17: 25,783,006 probably benign Het
Hist1h2bj G T 13: 22,043,251 probably benign Het
Hmg20b T A 10: 81,346,927 E139V probably damaging Het
Hsd3b6 G A 3: 98,807,905 T57I probably benign Het
Igkv5-48 A G 6: 69,726,796 S42P probably damaging Het
Igsf23 T C 7: 19,953,934 probably benign Het
Kcnt1 T C 2: 25,908,100 F874L probably damaging Het
Maf1 T C 15: 76,352,962 F110L possibly damaging Het
Mtpap C T 18: 4,387,044 R365W probably damaging Het
Mtus1 A C 8: 41,084,470 S70A possibly damaging Het
Nfatc1 T A 18: 80,697,865 T307S probably benign Het
Nup205 A G 6: 35,230,530 T1506A probably benign Het
Olfr1044 T A 2: 86,171,671 I49F probably damaging Het
Olfr275 T C 4: 52,825,450 S18P possibly damaging Het
Pcdhga8 A T 18: 37,727,709 Y606F probably damaging Het
Pde7a A G 3: 19,243,117 V123A probably benign Het
Pex1 C T 5: 3,624,426 T809I probably benign Het
Prdm13 C A 4: 21,678,243 R749L possibly damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Pros1 A T 16: 62,885,524 E67V probably damaging Het
Rab44 A G 17: 29,140,089 E417G possibly damaging Het
Rangrf A G 11: 68,973,640 probably null Het
Rp1 T A 1: 4,348,675 K738M probably damaging Het
Ryr2 A T 13: 11,668,820 D3119E probably damaging Het
Ryr2 G A 13: 11,745,752 R1482C probably damaging Het
Sbspon T A 1: 15,858,968 T200S probably damaging Het
Sfxn5 T C 6: 85,332,376 probably benign Het
Slc26a8 T A 17: 28,654,883 I377F probably benign Het
Slc30a7 A G 3: 115,993,008 F72L probably damaging Het
Slc32a1 T C 2: 158,614,192 F256L possibly damaging Het
Slco6b1 T C 1: 96,911,833 noncoding transcript Het
Smpd1 A G 7: 105,555,985 H357R probably benign Het
Sncaip A T 18: 52,871,384 H361L probably damaging Het
Tenm2 A C 11: 36,023,488 Y2406* probably null Het
Terb1 T A 8: 104,485,425 H308L probably benign Het
Trim61 A T 8: 65,013,418 L397H probably damaging Het
Trp53bp1 T A 2: 121,205,113 probably null Het
Ttn T G 2: 76,781,555 E9007D possibly damaging Het
Urb1 A T 16: 90,795,414 C319* probably null Het
Vmn2r95 T C 17: 18,451,653 Y551H probably damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Xdh A G 17: 73,898,335 L1045P probably damaging Het
Zfp638 T C 6: 83,979,475 I1688T possibly damaging Het
Zwint T A 10: 72,655,956 probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30463859 missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30462655 missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30463200 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9159:Nphs1 UTSW 7 30465601 missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30471169 missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9548:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9607:Nphs1 UTSW 7 30463587 missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30467566 missense probably benign 0.16
R9720:Nphs1 UTSW 7 30466074 missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30467530 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCTCATTGTCAGCCTACC -3'
(R):5'- CAGATTTACGGCCCGAGAAG -3'

Sequencing Primer
(F):5'- GTTACCATCCTGGGATCT -3'
(R):5'- ACTCACGGTAGCAGAGGC -3'
Posted On 2016-03-01