Mutagenetix > Incidental Mutation

Incidental Mutation 'R4850:Arap1'

373468

Institutional Source

Beutler Lab

Gene Symbol

Arap1

Ensembl Gene

ENSMUSG00000032812

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1

Synonyms

Centd2, 2410002L19Rik

MMRRC Submission

042462-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4850 (G1)

Quality Score

189

Status

Validated

Chromosome

Chromosomal Location

101348067-101412586 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101398791 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 847 (I847T)

Ref Sequence

ENSEMBL: ENSMUSP00000102624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084895] [ENSMUST00000084896] [ENSMUST00000098243] [ENSMUST00000107010] [ENSMUST00000155754]

AlphaFold

Q4LDD4

Predicted Effect

probably damaging
Transcript: ENSMUST00000084895
AA Change: I599T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081957
Gene: ENSMUSG00000032812
AA Change: I599T

Domain	Start	End	E-Value	Type
low complexity region	19	37	N/A	INTRINSIC
PH	82	175	2.62e-17	SMART
PH	195	285	3.6e-6	SMART
ArfGap	289	415	2.4e-22	SMART
PH	498	606	1.23e-13	SMART
PH	616	710	1.08e0	SMART
RhoGAP	722	904	1.35e-63	SMART
Pfam:RA	926	1015	1.5e-10	PFAM
PH	1029	1141	8.58e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000084896
AA Change: I847T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081958
Gene: ENSMUSG00000032812
AA Change: I847T

Domain	Start	End	E-Value	Type
SAM	3	70	1.72e-7	SMART
low complexity region	92	104	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	151	167	N/A	INTRINSIC
low complexity region	197	227	N/A	INTRINSIC
low complexity region	267	285	N/A	INTRINSIC
PH	330	423	2.62e-17	SMART
PH	443	533	3.6e-6	SMART
ArfGap	537	663	2.4e-22	SMART
PH	746	854	1.23e-13	SMART
PH	864	958	1.08e0	SMART
RhoGAP	970	1152	1.35e-63	SMART
Pfam:RA	1174	1263	6.6e-13	PFAM
PH	1277	1400	8e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098243
AA Change: I133T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095844
Gene: ENSMUSG00000032812
AA Change: I133T

Domain	Start	End	E-Value	Type
PH	32	140	1.23e-13	SMART
PH	150	244	1.08e0	SMART
RhoGAP	256	438	1.35e-63	SMART
Pfam:RA	460	549	1.2e-11	PFAM
PH	563	675	8.58e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107010
AA Change: I847T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102624
Gene: ENSMUSG00000032812
AA Change: I847T

Domain	Start	End	E-Value	Type
SAM	3	70	1.72e-7	SMART
low complexity region	92	104	N/A	INTRINSIC
low complexity region	115	126	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	151	167	N/A	INTRINSIC
low complexity region	197	227	N/A	INTRINSIC
low complexity region	267	285	N/A	INTRINSIC
PH	330	423	2.62e-17	SMART
PH	443	533	3.6e-6	SMART
ArfGap	537	663	2.4e-22	SMART
PH	746	854	1.23e-13	SMART
PH	864	958	1.08e0	SMART
RhoGAP	970	1152	1.35e-63	SMART
Pfam:RA	1174	1263	1.9e-10	PFAM
PH	1277	1389	8.58e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125284

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153340

Predicted Effect

probably benign
Transcript: ENSMUST00000155754

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156017

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213314

Meta Mutation Damage Score

0.9046

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,262,938	S3012P	unknown	Het
Abcb10	C	T	8: 123,982,690	A42T	probably benign	Het
Acsf3	T	C	8: 122,817,436	V551A	probably damaging	Het
Adgrl2	G	A	3: 148,859,020	T304I	probably damaging	Het
Akr1d1	A	G	6: 37,554,587		probably null	Het
Ankrd17	A	T	5: 90,264,786	H1226Q	probably damaging	Het
Atad2b	G	A	12: 4,943,251	G257S	probably benign	Het
Cand2	A	T	6: 115,801,948	T1158S	probably benign	Het
Cic	G	A	7: 25,272,902	R686H	probably damaging	Het
Cldn1	T	A	16: 26,363,163	T99S	probably benign	Het
Cnga3	G	T	1: 37,258,006	E173*	probably null	Het
Cryge	G	T	1: 65,051,052		probably benign	Het
Dsp	T	A	13: 38,192,469	L1410H	probably damaging	Het
Dync2h1	T	C	9: 7,134,364	T1548A	probably benign	Het
Dysf	C	A	6: 84,097,715	D499E	probably damaging	Het
Eml5	T	C	12: 98,790,619	D1917G	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam71d	A	G	12: 78,715,153	D197G	probably damaging	Het
Fn3krp	A	T	11: 121,425,053	H90L	possibly damaging	Het
Gm10718	A	T	9: 3,023,716	T56S	probably benign	Het
Gm4847	A	T	1: 166,642,339	I55K	probably damaging	Het
Gsn	T	A	2: 35,283,900		probably null	Het
Haghl	T	C	17: 25,783,006		probably benign	Het
Hist1h2bj	G	T	13: 22,043,251		probably benign	Het
Hmg20b	T	A	10: 81,346,927	E139V	probably damaging	Het
Hsd3b6	G	A	3: 98,807,905	T57I	probably benign	Het
Igkv5-48	A	G	6: 69,726,796	S42P	probably damaging	Het
Igsf23	T	C	7: 19,953,934		probably benign	Het
Kcnt1	T	C	2: 25,908,100	F874L	probably damaging	Het
Maf1	T	C	15: 76,352,962	F110L	possibly damaging	Het
Mtpap	C	T	18: 4,387,044	R365W	probably damaging	Het
Mtus1	A	C	8: 41,084,470	S70A	possibly damaging	Het
Nfatc1	T	A	18: 80,697,865	T307S	probably benign	Het
Nphs1	T	G	7: 30,463,232	S379A	possibly damaging	Het
Nup205	A	G	6: 35,230,530	T1506A	probably benign	Het
Olfr1044	T	A	2: 86,171,671	I49F	probably damaging	Het
Olfr275	T	C	4: 52,825,450	S18P	possibly damaging	Het
Pcdhga8	A	T	18: 37,727,709	Y606F	probably damaging	Het
Pde7a	A	G	3: 19,243,117	V123A	probably benign	Het
Pex1	C	T	5: 3,624,426	T809I	probably benign	Het
Prdm13	C	A	4: 21,678,243	R749L	possibly damaging	Het
Prkcd	A	G	14: 30,599,743	L498P	probably damaging	Het
Pros1	A	T	16: 62,885,524	E67V	probably damaging	Het
Rab44	A	G	17: 29,140,089	E417G	possibly damaging	Het
Rangrf	A	G	11: 68,973,640		probably null	Het
Rp1	T	A	1: 4,348,675	K738M	probably damaging	Het
Ryr2	A	T	13: 11,668,820	D3119E	probably damaging	Het
Ryr2	G	A	13: 11,745,752	R1482C	probably damaging	Het
Sbspon	T	A	1: 15,858,968	T200S	probably damaging	Het
Sfxn5	T	C	6: 85,332,376		probably benign	Het
Slc26a8	T	A	17: 28,654,883	I377F	probably benign	Het
Slc30a7	A	G	3: 115,993,008	F72L	probably damaging	Het
Slc32a1	T	C	2: 158,614,192	F256L	possibly damaging	Het
Slco6b1	T	C	1: 96,911,833		noncoding transcript	Het
Smpd1	A	G	7: 105,555,985	H357R	probably benign	Het
Sncaip	A	T	18: 52,871,384	H361L	probably damaging	Het
Tenm2	A	C	11: 36,023,488	Y2406*	probably null	Het
Terb1	T	A	8: 104,485,425	H308L	probably benign	Het
Trim61	A	T	8: 65,013,418	L397H	probably damaging	Het
Trp53bp1	T	A	2: 121,205,113		probably null	Het
Ttn	T	G	2: 76,781,555	E9007D	possibly damaging	Het
Urb1	A	T	16: 90,795,414	C319*	probably null	Het
Vmn2r95	T	C	17: 18,451,653	Y551H	probably damaging	Het
Vwde	A	T	6: 13,196,048	V326D	possibly damaging	Het
Xdh	A	G	17: 73,898,335	L1045P	probably damaging	Het
Zfp638	T	C	6: 83,979,475	I1688T	possibly damaging	Het
Zwint	T	A	10: 72,655,956		probably benign	Het

Other mutations in Arap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Arap1	APN	7	101388049	missense	probably damaging	0.96
IGL01311:Arap1	APN	7	101388136	nonsense	probably null
IGL01349:Arap1	APN	7	101387152	missense	possibly damaging	0.84
IGL01521:Arap1	APN	7	101400605	critical splice donor site	probably null
IGL01869:Arap1	APN	7	101400283	missense	probably damaging	1.00
IGL02156:Arap1	APN	7	101388730	unclassified	probably benign
IGL02320:Arap1	APN	7	101385029	missense	probably benign
IGL02478:Arap1	APN	7	101400125	splice site	probably null
R0133:Arap1	UTSW	7	101386229	missense	probably damaging	0.98
R0233:Arap1	UTSW	7	101400241	missense	possibly damaging	0.47
R0233:Arap1	UTSW	7	101400241	missense	possibly damaging	0.47
R0412:Arap1	UTSW	7	101390222	missense	probably damaging	0.98
R0616:Arap1	UTSW	7	101401650	missense	possibly damaging	0.64
R0838:Arap1	UTSW	7	101400412	missense	probably damaging	1.00
R0962:Arap1	UTSW	7	101384914	missense	possibly damaging	0.56
R1186:Arap1	UTSW	7	101404269	splice site	probably benign
R1405:Arap1	UTSW	7	101398436	splice site	probably null
R1405:Arap1	UTSW	7	101398436	splice site	probably null
R1724:Arap1	UTSW	7	101400526	missense	possibly damaging	0.91
R1793:Arap1	UTSW	7	101388622	missense	probably benign
R1959:Arap1	UTSW	7	101373015	missense	probably damaging	1.00
R1960:Arap1	UTSW	7	101373015	missense	probably damaging	1.00
R2020:Arap1	UTSW	7	101401518	missense	probably benign	0.00
R2128:Arap1	UTSW	7	101409320	missense	probably damaging	1.00
R3737:Arap1	UTSW	7	101400277	missense	possibly damaging	0.85
R3851:Arap1	UTSW	7	101390165	nonsense	probably null
R4034:Arap1	UTSW	7	101400277	missense	possibly damaging	0.85
R4386:Arap1	UTSW	7	101385571	missense	probably benign
R4435:Arap1	UTSW	7	101390254	missense	possibly damaging	0.74
R4779:Arap1	UTSW	7	101404367	missense	probably damaging	1.00
R4786:Arap1	UTSW	7	101385005	missense	possibly damaging	0.94
R4942:Arap1	UTSW	7	101401802	missense	possibly damaging	0.95
R5253:Arap1	UTSW	7	101388644	missense	probably benign	0.00
R5342:Arap1	UTSW	7	101404960	missense	probably benign	0.00
R5367:Arap1	UTSW	7	101409130	missense	probably damaging	0.99
R5397:Arap1	UTSW	7	101384912	missense	possibly damaging	0.95
R5968:Arap1	UTSW	7	101394738	missense	probably damaging	1.00
R6052:Arap1	UTSW	7	101404033	missense	probably damaging	1.00
R6574:Arap1	UTSW	7	101404001	missense	probably damaging	1.00
R6645:Arap1	UTSW	7	101408111	missense	possibly damaging	0.57
R7060:Arap1	UTSW	7	101409357	splice site	probably null
R7191:Arap1	UTSW	7	101384992	missense	probably benign	0.31
R7323:Arap1	UTSW	7	101400211	missense	probably damaging	1.00
R7349:Arap1	UTSW	7	101390228	missense	possibly damaging	0.95
R7516:Arap1	UTSW	7	101409331	missense	probably benign	0.00
R7922:Arap1	UTSW	7	101404414	nonsense	probably null
R8034:Arap1	UTSW	7	101394773	missense	probably damaging	1.00
R8293:Arap1	UTSW	7	101400934	missense	probably benign
R8493:Arap1	UTSW	7	101386518	nonsense	probably null
R8810:Arap1	UTSW	7	101404378	missense	probably damaging	0.99
R8811:Arap1	UTSW	7	101387196	missense	probably damaging	1.00
R8928:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R8930:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R8931:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R8941:Arap1	UTSW	7	101408117	missense	possibly damaging	0.52
R9014:Arap1	UTSW	7	101404333	missense	probably damaging	1.00
R9144:Arap1	UTSW	7	101398395	missense	probably damaging	1.00
R9164:Arap1	UTSW	7	101391883	nonsense	probably null
R9215:Arap1	UTSW	7	101400007	missense	probably benign	0.23
R9340:Arap1	UTSW	7	101388175	missense	probably damaging	1.00
R9519:Arap1	UTSW	7	101394739	start gained	probably benign
R9790:Arap1	UTSW	7	101388169	missense	probably benign	0.00
R9791:Arap1	UTSW	7	101388169	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGACCTTAGCTCATGAGGC -3'
(R):5'- AGGGCTACATCTGCATTGC -3'

Sequencing Primer
(F):5'- ACCTTAGCTCATGAGGCTGCAG -3'
(R):5'- CATCTGCATTGCCGTTGATCTGAG -3'

Posted On

2016-03-01