Incidental Mutation 'R4850:Fn3krp'
ID 373482
Institutional Source Beutler Lab
Gene Symbol Fn3krp
Ensembl Gene ENSMUSG00000039253
Gene Name fructosamine 3 kinase related protein
Synonyms
MMRRC Submission 042462-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R4850 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 121312227-121322114 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121315879 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 90 (H90L)
Ref Sequence ENSEMBL: ENSMUSP00000038061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038096]
AlphaFold Q8K274
Predicted Effect possibly damaging
Transcript: ENSMUST00000038096
AA Change: H90L

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038061
Gene: ENSMUSG00000039253
AA Change: H90L

DomainStartEndE-ValueType
Pfam:Fructosamin_kin 1 309 6e-81 PFAM
Pfam:APH 22 267 1.5e-12 PFAM
Meta Mutation Damage Score 0.4149 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of psicosamines and ribulosamines compared to the neighboring gene which encodes a highly similar enzyme, fructosamine-3-kinase, which has different substrate specificity. The activity of both enzymes may result in deglycation of proteins to restore their function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 124,709,429 (GRCm39) A42T probably benign Het
Acsf3 T C 8: 123,544,175 (GRCm39) V551A probably damaging Het
Adgrl2 G A 3: 148,564,656 (GRCm39) T304I probably damaging Het
Akr1d1 A G 6: 37,531,522 (GRCm39) probably null Het
Ankrd17 A T 5: 90,412,645 (GRCm39) H1226Q probably damaging Het
Arap1 T C 7: 101,047,998 (GRCm39) I847T probably damaging Het
Atad2b G A 12: 4,993,251 (GRCm39) G257S probably benign Het
Cand2 A T 6: 115,778,909 (GRCm39) T1158S probably benign Het
Cic G A 7: 24,972,327 (GRCm39) R686H probably damaging Het
Cldn1 T A 16: 26,181,913 (GRCm39) T99S probably benign Het
Cnga3 G T 1: 37,297,087 (GRCm39) E173* probably null Het
Cplane1 T C 15: 8,292,422 (GRCm39) S3012P unknown Het
Cryge G T 1: 65,090,211 (GRCm39) probably benign Het
Dsp T A 13: 38,376,445 (GRCm39) L1410H probably damaging Het
Dync2h1 T C 9: 7,134,364 (GRCm39) T1548A probably benign Het
Dysf C A 6: 84,074,697 (GRCm39) D499E probably damaging Het
Eml5 T C 12: 98,756,878 (GRCm39) D1917G probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Garin2 A G 12: 78,761,927 (GRCm39) D197G probably damaging Het
Gm10718 A T 9: 3,023,716 (GRCm39) T56S probably benign Het
Gm4847 A T 1: 166,469,908 (GRCm39) I55K probably damaging Het
Gsn T A 2: 35,173,912 (GRCm39) probably null Het
H2bc11 G T 13: 22,227,421 (GRCm39) probably benign Het
Haghl T C 17: 26,001,980 (GRCm39) probably benign Het
Hmg20b T A 10: 81,182,761 (GRCm39) E139V probably damaging Het
Hsd3b6 G A 3: 98,715,221 (GRCm39) T57I probably benign Het
Igkv5-48 A G 6: 69,703,780 (GRCm39) S42P probably damaging Het
Igsf23 T C 7: 19,687,859 (GRCm39) probably benign Het
Kcnt1 T C 2: 25,798,112 (GRCm39) F874L probably damaging Het
Maf1 T C 15: 76,237,162 (GRCm39) F110L possibly damaging Het
Mtpap C T 18: 4,387,044 (GRCm39) R365W probably damaging Het
Mtus1 A C 8: 41,537,507 (GRCm39) S70A possibly damaging Het
Nfatc1 T A 18: 80,741,080 (GRCm39) T307S probably benign Het
Nphs1 T G 7: 30,162,657 (GRCm39) S379A possibly damaging Het
Nup205 A G 6: 35,207,465 (GRCm39) T1506A probably benign Het
Or13f5 T C 4: 52,825,450 (GRCm39) S18P possibly damaging Het
Or8u9 T A 2: 86,002,015 (GRCm39) I49F probably damaging Het
Pcdhga8 A T 18: 37,860,762 (GRCm39) Y606F probably damaging Het
Pde7a A G 3: 19,297,281 (GRCm39) V123A probably benign Het
Pex1 C T 5: 3,674,426 (GRCm39) T809I probably benign Het
Prdm13 C A 4: 21,678,243 (GRCm39) R749L possibly damaging Het
Prkcd A G 14: 30,321,700 (GRCm39) L498P probably damaging Het
Pros1 A T 16: 62,705,887 (GRCm39) E67V probably damaging Het
Rab44 A G 17: 29,359,063 (GRCm39) E417G possibly damaging Het
Rangrf A G 11: 68,864,466 (GRCm39) probably null Het
Rp1 T A 1: 4,418,898 (GRCm39) K738M probably damaging Het
Ryr2 A T 13: 11,683,706 (GRCm39) D3119E probably damaging Het
Ryr2 G A 13: 11,760,638 (GRCm39) R1482C probably damaging Het
Sbspon T A 1: 15,929,192 (GRCm39) T200S probably damaging Het
Sfxn5 T C 6: 85,309,358 (GRCm39) probably benign Het
Slc26a8 T A 17: 28,873,857 (GRCm39) I377F probably benign Het
Slc30a7 A G 3: 115,786,657 (GRCm39) F72L probably damaging Het
Slc32a1 T C 2: 158,456,112 (GRCm39) F256L possibly damaging Het
Slco6b1 T C 1: 96,839,558 (GRCm39) noncoding transcript Het
Smpd1 A G 7: 105,205,192 (GRCm39) H357R probably benign Het
Sncaip A T 18: 53,004,456 (GRCm39) H361L probably damaging Het
Tenm2 A C 11: 35,914,315 (GRCm39) Y2406* probably null Het
Terb1 T A 8: 105,212,057 (GRCm39) H308L probably benign Het
Trim61 A T 8: 65,466,070 (GRCm39) L397H probably damaging Het
Trp53bp1 T A 2: 121,035,594 (GRCm39) probably null Het
Ttn T G 2: 76,611,899 (GRCm39) E9007D possibly damaging Het
Urb1 A T 16: 90,592,302 (GRCm39) C319* probably null Het
Vmn2r95 T C 17: 18,671,915 (GRCm39) Y551H probably damaging Het
Vwde A T 6: 13,196,047 (GRCm39) V326D possibly damaging Het
Xdh A G 17: 74,205,330 (GRCm39) L1045P probably damaging Het
Zfp638 T C 6: 83,956,457 (GRCm39) I1688T possibly damaging Het
Zwint T A 10: 72,491,788 (GRCm39) probably benign Het
Other mutations in Fn3krp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Fn3krp APN 11 121,312,380 (GRCm39) missense probably damaging 1.00
IGL01633:Fn3krp APN 11 121,320,533 (GRCm39) nonsense probably null
IGL02123:Fn3krp APN 11 121,320,270 (GRCm39) missense probably benign 0.00
IGL03189:Fn3krp APN 11 121,320,456 (GRCm39) missense probably damaging 1.00
R0278:Fn3krp UTSW 11 121,312,406 (GRCm39) missense probably damaging 1.00
R1927:Fn3krp UTSW 11 121,315,803 (GRCm39) missense probably damaging 0.99
R3744:Fn3krp UTSW 11 121,317,531 (GRCm39) critical splice donor site probably null
R4471:Fn3krp UTSW 11 121,317,499 (GRCm39) missense probably benign 0.01
R5027:Fn3krp UTSW 11 121,320,274 (GRCm39) missense probably benign 0.01
R5162:Fn3krp UTSW 11 121,320,410 (GRCm39) missense probably damaging 1.00
R5444:Fn3krp UTSW 11 121,312,430 (GRCm39) critical splice donor site probably null
R6230:Fn3krp UTSW 11 121,316,418 (GRCm39) missense probably damaging 1.00
R7183:Fn3krp UTSW 11 121,312,431 (GRCm39) critical splice donor site probably null
R8802:Fn3krp UTSW 11 121,315,813 (GRCm39) missense probably damaging 0.99
R9765:Fn3krp UTSW 11 121,312,304 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CCTCTGGCTAGCATAAATGTGG -3'
(R):5'- TCATCATAAGTGCAGTGACGG -3'

Sequencing Primer
(F):5'- GCCAGAAGTAATCATGTCTGC -3'
(R):5'- GTGACGGACACTTTACACCAC -3'
Posted On 2016-03-01