Incidental Mutation 'R4850:Eml5'
ID373485
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Nameechinoderm microtubule associated protein like 5
SynonymsC130068M19Rik
MMRRC Submission 042462-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R4850 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98786805-98901484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98790619 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1917 (D1917G)
Ref Sequence ENSEMBL: ENSMUSP00000065643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021399] [ENSMUST00000057000] [ENSMUST00000065716] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000221532] [ENSMUST00000223282]
Predicted Effect probably benign
Transcript: ENSMUST00000021399
SMART Domains Protein: ENSMUSP00000021399
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 69 91 N/A INTRINSIC
ZnF_C3H1 170 193 7.16e-1 SMART
ZnF_C3H1 195 214 5.27e1 SMART
ZnF_C3H1 250 272 5.55e0 SMART
Pfam:zf-CCCH_2 273 290 1.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057000
SMART Domains Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 440 463 7.16e-1 SMART
ZnF_C3H1 465 484 5.27e1 SMART
ZnF_C3H1 520 542 5.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065716
AA Change: D1917G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: D1917G

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110104
SMART Domains Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 465 488 7.16e-1 SMART
ZnF_C3H1 490 509 5.27e1 SMART
ZnF_C3H1 545 567 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110105
SMART Domains Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 596 619 7.16e-1 SMART
ZnF_C3H1 621 640 5.27e1 SMART
ZnF_C3H1 676 698 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221107
Predicted Effect probably benign
Transcript: ENSMUST00000221532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221902
Predicted Effect probably benign
Transcript: ENSMUST00000222097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222717
Predicted Effect probably damaging
Transcript: ENSMUST00000223282
AA Change: D1964G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.7057 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcb10 C T 8: 123,982,690 A42T probably benign Het
Acsf3 T C 8: 122,817,436 V551A probably damaging Het
Adgrl2 G A 3: 148,859,020 T304I probably damaging Het
Akr1d1 A G 6: 37,554,587 probably null Het
Ankrd17 A T 5: 90,264,786 H1226Q probably damaging Het
Arap1 T C 7: 101,398,791 I847T probably damaging Het
Atad2b G A 12: 4,943,251 G257S probably benign Het
Cand2 A T 6: 115,801,948 T1158S probably benign Het
Cic G A 7: 25,272,902 R686H probably damaging Het
Cldn1 T A 16: 26,363,163 T99S probably benign Het
Cnga3 G T 1: 37,258,006 E173* probably null Het
Cryge G T 1: 65,051,052 probably benign Het
Dsp T A 13: 38,192,469 L1410H probably damaging Het
Dync2h1 T C 9: 7,134,364 T1548A probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam71d A G 12: 78,715,153 D197G probably damaging Het
Fn3krp A T 11: 121,425,053 H90L possibly damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm4847 A T 1: 166,642,339 I55K probably damaging Het
Gsn T A 2: 35,283,900 probably null Het
Haghl T C 17: 25,783,006 probably benign Het
Hist1h2bj G T 13: 22,043,251 probably benign Het
Hmg20b T A 10: 81,346,927 E139V probably damaging Het
Hsd3b6 G A 3: 98,807,905 T57I probably benign Het
Igkv5-48 A G 6: 69,726,796 S42P probably damaging Het
Igsf23 T C 7: 19,953,934 probably benign Het
Kcnt1 T C 2: 25,908,100 F874L probably damaging Het
Maf1 T C 15: 76,352,962 F110L possibly damaging Het
Mtpap C T 18: 4,387,044 R365W probably damaging Het
Mtus1 A C 8: 41,084,470 S70A possibly damaging Het
Nfatc1 T A 18: 80,697,865 T307S probably benign Het
Nphs1 T G 7: 30,463,232 S379A possibly damaging Het
Nup205 A G 6: 35,230,530 T1506A probably benign Het
Olfr1044 T A 2: 86,171,671 I49F probably damaging Het
Olfr275 T C 4: 52,825,450 S18P possibly damaging Het
Pcdhga8 A T 18: 37,727,709 Y606F probably damaging Het
Pde7a A G 3: 19,243,117 V123A probably benign Het
Pex1 C T 5: 3,624,426 T809I probably benign Het
Prdm13 C A 4: 21,678,243 R749L possibly damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Pros1 A T 16: 62,885,524 E67V probably damaging Het
Rab44 A G 17: 29,140,089 E417G possibly damaging Het
Rangrf A G 11: 68,973,640 probably null Het
Rp1 T A 1: 4,348,675 K738M probably damaging Het
Ryr2 A T 13: 11,668,820 D3119E probably damaging Het
Ryr2 G A 13: 11,745,752 R1482C probably damaging Het
Sbspon T A 1: 15,858,968 T200S probably damaging Het
Sfxn5 T C 6: 85,332,376 probably benign Het
Slc26a8 T A 17: 28,654,883 I377F probably benign Het
Slc30a7 A G 3: 115,993,008 F72L probably damaging Het
Slc32a1 T C 2: 158,614,192 F256L possibly damaging Het
Slco6b1 T C 1: 96,911,833 noncoding transcript Het
Smpd1 A G 7: 105,555,985 H357R probably benign Het
Sncaip A T 18: 52,871,384 H361L probably damaging Het
Tenm2 A C 11: 36,023,488 Y2406* probably null Het
Terb1 T A 8: 104,485,425 H308L probably benign Het
Trim61 A T 8: 65,013,418 L397H probably damaging Het
Trp53bp1 T A 2: 121,205,113 probably null Het
Ttn T G 2: 76,781,555 E9007D possibly damaging Het
Urb1 A T 16: 90,795,414 C319* probably null Het
Vmn2r95 T C 17: 18,451,653 Y551H probably damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Xdh A G 17: 73,898,335 L1045P probably damaging Het
Zfp638 T C 6: 83,979,475 I1688T possibly damaging Het
Zwint T A 10: 72,655,956 probably benign Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
R7353:Eml5 UTSW 12 98825424 missense
R7644:Eml5 UTSW 12 98855944 missense probably benign 0.05
R7694:Eml5 UTSW 12 98792563 missense probably damaging 0.99
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTTGCCAGCTACAATAACTC -3'
(R):5'- ATGACCTAGTTTGTTGTACGCAG -3'

Sequencing Primer
(F):5'- GCCAGCTACAATAACTCGTTTTGGTG -3'
(R):5'- GTTGTACGCAGACCTGTAAAC -3'
Posted On2016-03-01