Mutagenetix > Incidental Mutation

Incidental Mutation 'R4850:Pros1'

373494

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

042462-MU

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4850 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62885524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 67 (E67V)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

AlphaFold

Q08761

Predicted Effect

probably damaging
Transcript: ENSMUST00000023629
AA Change: E67V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: E67V

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Meta Mutation Damage Score

0.9354

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,262,938	S3012P	unknown	Het
Abcb10	C	T	8: 123,982,690	A42T	probably benign	Het
Acsf3	T	C	8: 122,817,436	V551A	probably damaging	Het
Adgrl2	G	A	3: 148,859,020	T304I	probably damaging	Het
Akr1d1	A	G	6: 37,554,587		probably null	Het
Ankrd17	A	T	5: 90,264,786	H1226Q	probably damaging	Het
Arap1	T	C	7: 101,398,791	I847T	probably damaging	Het
Atad2b	G	A	12: 4,943,251	G257S	probably benign	Het
Cand2	A	T	6: 115,801,948	T1158S	probably benign	Het
Cic	G	A	7: 25,272,902	R686H	probably damaging	Het
Cldn1	T	A	16: 26,363,163	T99S	probably benign	Het
Cnga3	G	T	1: 37,258,006	E173*	probably null	Het
Cryge	G	T	1: 65,051,052		probably benign	Het
Dsp	T	A	13: 38,192,469	L1410H	probably damaging	Het
Dync2h1	T	C	9: 7,134,364	T1548A	probably benign	Het
Dysf	C	A	6: 84,097,715	D499E	probably damaging	Het
Eml5	T	C	12: 98,790,619	D1917G	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam71d	A	G	12: 78,715,153	D197G	probably damaging	Het
Fn3krp	A	T	11: 121,425,053	H90L	possibly damaging	Het
Gm10718	A	T	9: 3,023,716	T56S	probably benign	Het
Gm4847	A	T	1: 166,642,339	I55K	probably damaging	Het
Gsn	T	A	2: 35,283,900		probably null	Het
Haghl	T	C	17: 25,783,006		probably benign	Het
Hist1h2bj	G	T	13: 22,043,251		probably benign	Het
Hmg20b	T	A	10: 81,346,927	E139V	probably damaging	Het
Hsd3b6	G	A	3: 98,807,905	T57I	probably benign	Het
Igkv5-48	A	G	6: 69,726,796	S42P	probably damaging	Het
Igsf23	T	C	7: 19,953,934		probably benign	Het
Kcnt1	T	C	2: 25,908,100	F874L	probably damaging	Het
Maf1	T	C	15: 76,352,962	F110L	possibly damaging	Het
Mtpap	C	T	18: 4,387,044	R365W	probably damaging	Het
Mtus1	A	C	8: 41,084,470	S70A	possibly damaging	Het
Nfatc1	T	A	18: 80,697,865	T307S	probably benign	Het
Nphs1	T	G	7: 30,463,232	S379A	possibly damaging	Het
Nup205	A	G	6: 35,230,530	T1506A	probably benign	Het
Olfr1044	T	A	2: 86,171,671	I49F	probably damaging	Het
Olfr275	T	C	4: 52,825,450	S18P	possibly damaging	Het
Pcdhga8	A	T	18: 37,727,709	Y606F	probably damaging	Het
Pde7a	A	G	3: 19,243,117	V123A	probably benign	Het
Pex1	C	T	5: 3,624,426	T809I	probably benign	Het
Prdm13	C	A	4: 21,678,243	R749L	possibly damaging	Het
Prkcd	A	G	14: 30,599,743	L498P	probably damaging	Het
Rab44	A	G	17: 29,140,089	E417G	possibly damaging	Het
Rangrf	A	G	11: 68,973,640		probably null	Het
Rp1	T	A	1: 4,348,675	K738M	probably damaging	Het
Ryr2	A	T	13: 11,668,820	D3119E	probably damaging	Het
Ryr2	G	A	13: 11,745,752	R1482C	probably damaging	Het
Sbspon	T	A	1: 15,858,968	T200S	probably damaging	Het
Sfxn5	T	C	6: 85,332,376		probably benign	Het
Slc26a8	T	A	17: 28,654,883	I377F	probably benign	Het
Slc30a7	A	G	3: 115,993,008	F72L	probably damaging	Het
Slc32a1	T	C	2: 158,614,192	F256L	possibly damaging	Het
Slco6b1	T	C	1: 96,911,833		noncoding transcript	Het
Smpd1	A	G	7: 105,555,985	H357R	probably benign	Het
Sncaip	A	T	18: 52,871,384	H361L	probably damaging	Het
Tenm2	A	C	11: 36,023,488	Y2406*	probably null	Het
Terb1	T	A	8: 104,485,425	H308L	probably benign	Het
Trim61	A	T	8: 65,013,418	L397H	probably damaging	Het
Trp53bp1	T	A	2: 121,205,113		probably null	Het
Ttn	T	G	2: 76,781,555	E9007D	possibly damaging	Het
Urb1	A	T	16: 90,795,414	C319*	probably null	Het
Vmn2r95	T	C	17: 18,451,653	Y551H	probably damaging	Het
Vwde	A	T	6: 13,196,048	V326D	possibly damaging	Het
Xdh	A	G	17: 73,898,335	L1045P	probably damaging	Het
Zfp638	T	C	6: 83,979,475	I1688T	possibly damaging	Het
Zwint	T	A	10: 72,655,956		probably benign	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R7980:Pros1	UTSW	16	62928153	missense	possibly damaging	0.86
R8234:Pros1	UTSW	16	62928177	missense	possibly damaging	0.73
R8479:Pros1	UTSW	16	62907739	missense	probably damaging	1.00
R8514:Pros1	UTSW	16	62910109	missense	probably benign	0.03
R8827:Pros1	UTSW	16	62926464	missense	probably benign	0.13
R9131:Pros1	UTSW	16	62928034	missense	probably damaging	0.96
R9484:Pros1	UTSW	16	62924524	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- ACCTGCTGCTTGAGTTGTTAAC -3'
(R):5'- TGGCAGTCTTCCTGAAGTGAC -3'

Sequencing Primer
(F):5'- CTGCTGCTTGAGTTGTTAACCAAAG -3'
(R):5'- CTGAAGTGACAGGGTGACAC -3'

Posted On

2016-03-01