Incidental Mutation 'R4850:Vmn2r95'
ID373496
Institutional Source Beutler Lab
Gene Symbol Vmn2r95
Ensembl Gene ENSMUSG00000091631
Gene Namevomeronasal 2, receptor 95
Synonyms
MMRRC Submission 042462-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R4850 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location18424078-18460905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18451653 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 551 (Y551H)
Ref Sequence ENSEMBL: ENSMUSP00000156383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166327] [ENSMUST00000232090] [ENSMUST00000232464]
Predicted Effect probably benign
Transcript: ENSMUST00000166327
SMART Domains Protein: ENSMUSP00000126106
Gene: ENSMUSG00000091631

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 462 1.8e-35 PFAM
Pfam:NCD3G 509 562 3.2e-20 PFAM
Pfam:7tm_3 594 830 3.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000232090
AA Change: Y623H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232464
AA Change: Y551H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcb10 C T 8: 123,982,690 A42T probably benign Het
Acsf3 T C 8: 122,817,436 V551A probably damaging Het
Adgrl2 G A 3: 148,859,020 T304I probably damaging Het
Akr1d1 A G 6: 37,554,587 probably null Het
Ankrd17 A T 5: 90,264,786 H1226Q probably damaging Het
Arap1 T C 7: 101,398,791 I847T probably damaging Het
Atad2b G A 12: 4,943,251 G257S probably benign Het
Cand2 A T 6: 115,801,948 T1158S probably benign Het
Cic G A 7: 25,272,902 R686H probably damaging Het
Cldn1 T A 16: 26,363,163 T99S probably benign Het
Cnga3 G T 1: 37,258,006 E173* probably null Het
Cryge G T 1: 65,051,052 probably benign Het
Dsp T A 13: 38,192,469 L1410H probably damaging Het
Dync2h1 T C 9: 7,134,364 T1548A probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eml5 T C 12: 98,790,619 D1917G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam71d A G 12: 78,715,153 D197G probably damaging Het
Fn3krp A T 11: 121,425,053 H90L possibly damaging Het
Gm10718 A T 9: 3,023,716 T56S probably benign Het
Gm4847 A T 1: 166,642,339 I55K probably damaging Het
Gsn T A 2: 35,283,900 probably null Het
Haghl T C 17: 25,783,006 probably benign Het
Hist1h2bj G T 13: 22,043,251 probably benign Het
Hmg20b T A 10: 81,346,927 E139V probably damaging Het
Hsd3b6 G A 3: 98,807,905 T57I probably benign Het
Igkv5-48 A G 6: 69,726,796 S42P probably damaging Het
Igsf23 T C 7: 19,953,934 probably benign Het
Kcnt1 T C 2: 25,908,100 F874L probably damaging Het
Maf1 T C 15: 76,352,962 F110L possibly damaging Het
Mtpap C T 18: 4,387,044 R365W probably damaging Het
Mtus1 A C 8: 41,084,470 S70A possibly damaging Het
Nfatc1 T A 18: 80,697,865 T307S probably benign Het
Nphs1 T G 7: 30,463,232 S379A possibly damaging Het
Nup205 A G 6: 35,230,530 T1506A probably benign Het
Olfr1044 T A 2: 86,171,671 I49F probably damaging Het
Olfr275 T C 4: 52,825,450 S18P possibly damaging Het
Pcdhga8 A T 18: 37,727,709 Y606F probably damaging Het
Pde7a A G 3: 19,243,117 V123A probably benign Het
Pex1 C T 5: 3,624,426 T809I probably benign Het
Prdm13 C A 4: 21,678,243 R749L possibly damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Pros1 A T 16: 62,885,524 E67V probably damaging Het
Rab44 A G 17: 29,140,089 E417G possibly damaging Het
Rangrf A G 11: 68,973,640 probably null Het
Rp1 T A 1: 4,348,675 K738M probably damaging Het
Ryr2 A T 13: 11,668,820 D3119E probably damaging Het
Ryr2 G A 13: 11,745,752 R1482C probably damaging Het
Sbspon T A 1: 15,858,968 T200S probably damaging Het
Sfxn5 T C 6: 85,332,376 probably benign Het
Slc26a8 T A 17: 28,654,883 I377F probably benign Het
Slc30a7 A G 3: 115,993,008 F72L probably damaging Het
Slc32a1 T C 2: 158,614,192 F256L possibly damaging Het
Slco6b1 T C 1: 96,911,833 noncoding transcript Het
Smpd1 A G 7: 105,555,985 H357R probably benign Het
Sncaip A T 18: 52,871,384 H361L probably damaging Het
Tenm2 A C 11: 36,023,488 Y2406* probably null Het
Terb1 T A 8: 104,485,425 H308L probably benign Het
Trim61 A T 8: 65,013,418 L397H probably damaging Het
Trp53bp1 T A 2: 121,205,113 probably null Het
Ttn T G 2: 76,781,555 E9007D possibly damaging Het
Urb1 A T 16: 90,795,414 C319* probably null Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Xdh A G 17: 73,898,335 L1045P probably damaging Het
Zfp638 T C 6: 83,979,475 I1688T possibly damaging Het
Zwint T A 10: 72,655,956 probably benign Het
Other mutations in Vmn2r95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r95 APN 17 18452328 utr 3 prime probably benign
IGL01479:Vmn2r95 APN 17 18443862 missense probably damaging 1.00
IGL01890:Vmn2r95 APN 17 18451475 missense probably damaging 1.00
IGL01986:Vmn2r95 APN 17 18440211 missense probably benign 0.06
IGL02113:Vmn2r95 APN 17 18439907 missense possibly damaging 0.47
IGL02154:Vmn2r95 APN 17 18451986 missense probably benign 0.16
IGL02190:Vmn2r95 APN 17 18451776 missense probably benign 0.00
IGL02412:Vmn2r95 APN 17 18439956 missense probably damaging 1.00
IGL02550:Vmn2r95 APN 17 18451732 missense probably damaging 1.00
IGL02679:Vmn2r95 APN 17 18443854 missense probably damaging 1.00
IGL02691:Vmn2r95 APN 17 18451858 missense probably benign 0.07
IGL02990:Vmn2r95 APN 17 18452036 nonsense probably null
IGL03032:Vmn2r95 APN 17 18452313 missense probably benign 0.00
R0416:Vmn2r95 UTSW 17 18441402 missense probably damaging 1.00
R0448:Vmn2r95 UTSW 17 18451743 missense possibly damaging 0.92
R0514:Vmn2r95 UTSW 17 18451582 missense probably benign
R0519:Vmn2r95 UTSW 17 18439503 missense probably damaging 1.00
R0539:Vmn2r95 UTSW 17 18452100 missense probably damaging 1.00
R1501:Vmn2r95 UTSW 17 18439856 missense probably damaging 0.99
R1598:Vmn2r95 UTSW 17 18452313 missense probably benign 0.03
R1613:Vmn2r95 UTSW 17 18440639 splice site probably benign
R1861:Vmn2r95 UTSW 17 18452268 missense probably damaging 1.00
R1921:Vmn2r95 UTSW 17 18424313 missense probably benign 0.11
R1986:Vmn2r95 UTSW 17 18451543 missense probably benign
R2031:Vmn2r95 UTSW 17 18439455 missense possibly damaging 0.94
R2040:Vmn2r95 UTSW 17 18441299 missense probably damaging 1.00
R3608:Vmn2r95 UTSW 17 18439973 missense possibly damaging 0.47
R3727:Vmn2r95 UTSW 17 18441482 nonsense probably null
R3953:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R3955:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R3957:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R4474:Vmn2r95 UTSW 17 18452245 missense probably damaging 1.00
R4672:Vmn2r95 UTSW 17 18452151 missense probably damaging 1.00
R5054:Vmn2r95 UTSW 17 18451446 missense possibly damaging 0.63
R5178:Vmn2r95 UTSW 17 18440075 missense probably benign 0.01
R5980:Vmn2r95 UTSW 17 18441362 missense probably benign
R6183:Vmn2r95 UTSW 17 18443930 missense probably damaging 0.99
R6276:Vmn2r95 UTSW 17 18451470 missense possibly damaging 0.96
R6651:Vmn2r95 UTSW 17 18440360 missense probably damaging 1.00
R6682:Vmn2r95 UTSW 17 18440227 missense probably damaging 1.00
R6797:Vmn2r95 UTSW 17 18452289 utr 3 prime probably benign
R6799:Vmn2r95 UTSW 17 18439293 missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18443919 missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18443920 missense probably damaging 1.00
R6982:Vmn2r95 UTSW 17 18452061 missense probably damaging 1.00
R7203:Vmn2r95 UTSW 17 18441315 missense probably benign 0.01
R7226:Vmn2r95 UTSW 17 18451983 missense possibly damaging 0.90
R7240:Vmn2r95 UTSW 17 18451963 missense probably benign 0.15
R7383:Vmn2r95 UTSW 17 18440472 missense probably benign 0.06
R7614:Vmn2r95 UTSW 17 18440090 missense probably benign
R7755:Vmn2r95 UTSW 17 18424105 start codon destroyed probably null 0.99
Z1088:Vmn2r95 UTSW 17 18440401 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGTGTGTGAAGTGTCCAG -3'
(R):5'- TCTCCCTGGAAAACTGACCTTAAAG -3'

Sequencing Primer
(F):5'- AGTGTCCAGAGAGTCATTATGC -3'
(R):5'- TGACCTTAAAGGCAAGGACC -3'
Posted On2016-03-01