Mutagenetix > Incidental Mutation

Incidental Mutation 'R4851:Nfasc'

373513

Institutional Source

Beutler Lab

Gene Symbol

Nfasc

Ensembl Gene

ENSMUSG00000026442

Gene Name

neurofascin

Synonyms

D430023G06Rik

MMRRC Submission

042463-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4851 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

132564690-132741797 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 132602021 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 807 (F807S)

Ref Sequence

ENSEMBL: ENSMUSP00000139955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861] [ENSMUST00000188307]

AlphaFold

Q810U3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043189
AA Change: F786S

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442
AA Change: F786S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	42	131	4.5e0	SMART
IG	141	228	2.44e-7	SMART
IGc2	253	317	1.53e-17	SMART
IGc2	343	409	1.76e-8	SMART
IGc2	437	502	2.39e-10	SMART
IGc2	528	593	2.54e-5	SMART
FN3	607	690	2.17e-11	SMART
FN3	707	789	2.85e-6	SMART
FN3	805	896	2.21e-3	SMART
FN3	911	995	9.92e-6	SMART
low complexity region	996	1018	N/A	INTRINSIC
transmembrane domain	1026	1048	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1049	1133	1.4e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000094569
AA Change: F807S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: F807S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	48	137	4.5e0	SMART
IG	147	234	2.44e-7	SMART
IGc2	259	323	1.53e-17	SMART
IGc2	349	415	1.76e-8	SMART
IGc2	443	508	2.39e-10	SMART
IGc2	534	599	2.54e-5	SMART
FN3	628	711	2.17e-11	SMART
FN3	728	810	2.85e-6	SMART
FN3	825	909	9.92e-6	SMART
FN3	1010	1086	6.91e-5	SMART
transmembrane domain	1109	1131	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1132	1216	2.2e-29	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163770
AA Change: F803S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442
AA Change: F803S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	42	131	4.5e0	SMART
IG	141	228	2.44e-7	SMART
IGc2	270	334	1.53e-17	SMART
IGc2	360	426	1.76e-8	SMART
IGc2	454	519	2.39e-10	SMART
IGc2	545	610	2.54e-5	SMART
FN3	624	707	2.17e-11	SMART
FN3	724	806	2.85e-6	SMART
FN3	822	913	2.21e-3	SMART
FN3	928	1012	9.92e-6	SMART
low complexity region	1013	1035	N/A	INTRINSIC
transmembrane domain	1043	1065	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1066	1150	5e-30	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000186389
AA Change: F787S

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186539

Predicted Effect

probably damaging
Transcript: ENSMUST00000187861
AA Change: F807S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: F807S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	48	137	1.8e-2	SMART
IG	147	234	1e-9	SMART
IGc2	259	323	6.4e-20	SMART
IGc2	349	415	7e-11	SMART
IGc2	443	508	9.7e-13	SMART
IGc2	534	599	1.1e-7	SMART
FN3	628	711	1e-13	SMART
FN3	728	810	1.4e-8	SMART
FN3	826	917	1.1e-5	SMART
FN3	932	1016	4.8e-8	SMART
FN3	1117	1193	3.4e-7	SMART
transmembrane domain	1216	1238	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1239	1325	2.6e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000188307
AA Change: F801S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000139520
Gene: ENSMUSG00000026442
AA Change: F801S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	42	131	1.8e-2	SMART
IG	141	228	1e-9	SMART
IGc2	253	317	6.4e-20	SMART
IGc2	343	409	7e-11	SMART
IGc2	437	502	9.7e-13	SMART
IGc2	528	593	1.1e-7	SMART
FN3	622	705	1e-13	SMART
FN3	722	804	1.4e-8	SMART
FN3	820	890	3.8e-1	SMART

Meta Mutation Damage Score

0.1743

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (99/99)

MGI Phenotype

FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930451G09Rik	A	G	16: 4,976,274		noncoding transcript	Het
Abca13	A	T	11: 9,483,890	R4148S	probably benign	Het
Acoxl	T	A	2: 128,044,391	L182Q	possibly damaging	Het
Aldh7a1	T	C	18: 56,532,016	T364A	possibly damaging	Het
App	T	C	16: 85,056,434	D252G	unknown	Het
Arid1a	A	G	4: 133,681,361	I1945T	unknown	Het
Arsk	C	T	13: 76,065,279		probably null	Het
Atad2b	G	A	12: 4,943,251	G257S	probably benign	Het
Best1	C	A	19: 9,991,698	R218L	probably damaging	Het
Cacna1e	A	T	1: 154,436,554		probably null	Het
Cdh13	C	T	8: 118,757,390	T130I	possibly damaging	Het
Cela2a	T	C	4: 141,825,591	E25G	probably benign	Het
Cgnl1	T	A	9: 71,725,032	I346F	probably damaging	Het
Chil6	C	T	3: 106,389,928	G299D	possibly damaging	Het
Cic	G	A	7: 25,272,902	R686H	probably damaging	Het
Cnpy1	T	C	5: 28,245,740	I23V	probably benign	Het
Col6a3	T	A	1: 90,779,289	Y2034F	unknown	Het
Coq10b	T	C	1: 55,071,744	Y224H	probably benign	Het
Cryge	G	T	1: 65,051,052		probably benign	Het
Cyb5rl	T	G	4: 107,084,313	S252A	probably benign	Het
Cyp2ab1	T	A	16: 20,315,064	R125S	probably damaging	Het
Dclk1	G	A	3: 55,480,390	G86R	probably damaging	Het
Dmtn	A	G	14: 70,604,814	M382T	probably damaging	Het
Dnah12	T	A	14: 26,716,629	L471*	probably null	Het
Dock10	A	T	1: 80,549,157	S782T	probably benign	Het
Egfem1	C	A	3: 29,151,883	H90N	possibly damaging	Het
Ephb6	T	A	6: 41,618,145	W698R	probably benign	Het
Exoc4	T	A	6: 33,918,408	C787S	probably damaging	Het
Exosc8	A	T	3: 54,732,102		probably benign	Het
Galc	T	A	12: 98,227,274	Q352L	probably benign	Het
Galns	A	G	8: 122,600,533	Y167H	probably damaging	Het
Glb1l	T	C	1: 75,208,884		probably benign	Het
Gm6185	A	T	1: 161,206,180		noncoding transcript	Het
Gm7694	T	C	1: 170,301,225	N245S	probably benign	Het
Gmcl1	T	G	6: 86,704,556	K385N	possibly damaging	Het
Gramd1c	A	T	16: 43,989,837	W463R	probably damaging	Het
Gtpbp8	C	G	16: 44,746,070	A90P	probably benign	Het
Hcar1	T	C	5: 123,878,668	E320G	probably benign	Het
Hhatl	T	C	9: 121,789,011	D226G	probably damaging	Het
Hist1h2bj	G	T	13: 22,043,251		probably benign	Het
Hoxc5	T	A	15: 103,015,369	I199N	probably damaging	Het
Iars2	T	C	1: 185,327,648	D121G	probably damaging	Het
Il5ra	T	A	6: 106,738,471	H134L	probably benign	Het
Isl2	T	A	9: 55,544,987	I281N	possibly damaging	Het
Kcnk13	T	C	12: 99,966,124	F60L	probably damaging	Het
Kdelr3	C	T	15: 79,524,865	T85M	possibly damaging	Het
Kdf1	A	T	4: 133,528,365	H131L	probably damaging	Het
Mipol1	T	A	12: 57,332,301	L182I	probably damaging	Het
Morc1	T	G	16: 48,561,617	S513R	probably benign	Het
Moxd2	A	T	6: 40,878,822	L611H	probably damaging	Het
Mpped2	T	C	2: 106,699,379		probably benign	Het
Mrpl51	T	C	6: 125,193,307	V92A	probably benign	Het
Mrps26	G	A	2: 130,563,761		probably benign	Het
Mrps5	A	G	2: 127,590,745	T29A	probably benign	Het
Mustn1	A	G	14: 30,879,560		probably benign	Het
Ncor2	G	A	5: 125,033,367	P858S	possibly damaging	Het
Nup50	G	A	15: 84,939,711	V422I	probably benign	Het
Olfr1044	T	A	2: 86,171,671	I49F	probably damaging	Het
Olfr1212	A	G	2: 88,958,586	N40S	probably damaging	Het
Olfr384	A	T	11: 73,603,057	H159L	probably damaging	Het
Olfr411	C	A	11: 74,346,943	V214L	probably benign	Het
Olfr417	T	A	1: 174,368,996	F26L	probably benign	Het
Olfr539	A	T	7: 140,667,313	M2L	probably benign	Het
Olfr695	A	T	7: 106,874,014	V77D	probably damaging	Het
Olfr907	T	A	9: 38,499,023	M118K	probably damaging	Het
Osbpl8	T	A	10: 111,204,800	M1K	probably null	Het
Pcdhb22	A	C	18: 37,519,034	D185A	possibly damaging	Het
Pcdhga8	G	T	18: 37,816,404	R291L	probably damaging	Het
Saysd1	A	T	14: 20,077,604	L84Q	possibly damaging	Het
Slc41a1	T	C	1: 131,830,770	I50T	probably benign	Het
Smg7	G	A	1: 152,844,269	P834S	probably benign	Het
Speer4a	C	T	5: 26,038,212	V92M	probably damaging	Het
Srf	T	C	17: 46,549,474	T461A	probably benign	Het
Ssu72	A	G	4: 155,715,596	D72G	possibly damaging	Het
Suco	T	C	1: 161,834,192	E890G	probably damaging	Het
Tenm3	A	G	8: 48,310,621		probably null	Het
Tm6sf1	A	G	7: 81,865,343	E7G	probably null	Het
Tm9sf2	A	G	14: 122,141,204	K240R	probably benign	Het
Tmem52	T	A	4: 155,470,368	Y149*	probably null	Het
Tpgs2	A	T	18: 25,151,248	Y68N	possibly damaging	Het
Vmn1r205	T	A	13: 22,592,904	E9D	probably benign	Het
Vmn2r32	A	G	7: 7,479,954	V7A	possibly damaging	Het
Vmn2r80	T	C	10: 79,194,322	Y661H	possibly damaging	Het
Vps39	G	A	2: 120,321,831		probably benign	Het
Vwde	A	T	6: 13,196,048	V326D	possibly damaging	Het
Zfp641	T	A	15: 98,288,717	S342C	probably damaging	Het
Zfp961	T	C	8: 71,969,003		probably benign	Het

Other mutations in Nfasc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Nfasc	APN	1	132573798	nonsense	probably null
IGL01088:Nfasc	APN	1	132642776	utr 5 prime	probably benign
IGL01958:Nfasc	APN	1	132608438	nonsense	probably null
IGL01999:Nfasc	APN	1	132605247	splice site	probably benign
IGL02170:Nfasc	APN	1	132610366	nonsense	probably null
IGL02187:Nfasc	APN	1	132570481	missense	probably damaging	1.00
IGL02192:Nfasc	APN	1	132570481	missense	probably damaging	1.00
IGL02452:Nfasc	APN	1	132620924	critical splice donor site	probably null
IGL02698:Nfasc	APN	1	132634737	missense	probably benign	0.06
IGL02797:Nfasc	APN	1	132610448	missense	probably damaging	1.00
IGL03000:Nfasc	APN	1	132621509	splice site	probably benign
IGL03027:Nfasc	APN	1	132610469	missense	probably damaging	1.00
Fascist	UTSW	1	132611605	missense	probably damaging	1.00
jiggle	UTSW	1	132602021	missense	probably damaging	1.00
Partisan	UTSW	1	132605549	missense	probably damaging	1.00
Tremble	UTSW	1	132611595	missense	probably damaging	1.00
PIT4377001:Nfasc	UTSW	1	132583066	missense	unknown
R0240:Nfasc	UTSW	1	132601983	missense	probably damaging	1.00
R0240:Nfasc	UTSW	1	132601983	missense	probably damaging	1.00
R0241:Nfasc	UTSW	1	132636993	missense	probably benign	0.02
R0241:Nfasc	UTSW	1	132636993	missense	probably benign	0.02
R0418:Nfasc	UTSW	1	132611595	missense	probably damaging	1.00
R0513:Nfasc	UTSW	1	132603846	missense	possibly damaging	0.95
R0639:Nfasc	UTSW	1	132603816	missense	probably damaging	1.00
R0646:Nfasc	UTSW	1	132608438	nonsense	probably null
R1103:Nfasc	UTSW	1	132607057	splice site	probably benign
R1269:Nfasc	UTSW	1	132610788	missense	probably damaging	1.00
R1550:Nfasc	UTSW	1	132608503	missense	probably damaging	0.96
R1749:Nfasc	UTSW	1	132611632	missense	probably damaging	1.00
R1773:Nfasc	UTSW	1	132610839	missense	probably damaging	1.00
R1921:Nfasc	UTSW	1	132610805	missense	probably damaging	1.00
R1987:Nfasc	UTSW	1	132610886	missense	probably damaging	1.00
R2141:Nfasc	UTSW	1	132596645	missense	probably damaging	1.00
R2239:Nfasc	UTSW	1	132583022	intron	probably benign
R2413:Nfasc	UTSW	1	132595505	missense	probably damaging	1.00
R2428:Nfasc	UTSW	1	132595654	missense	possibly damaging	0.55
R2472:Nfasc	UTSW	1	132588221	intron	probably benign
R2517:Nfasc	UTSW	1	132597763	splice site	probably null
R3850:Nfasc	UTSW	1	132631733	missense	probably damaging	1.00
R4050:Nfasc	UTSW	1	132610305	splice site	probably benign
R4061:Nfasc	UTSW	1	132597845	missense	probably damaging	1.00
R4088:Nfasc	UTSW	1	132595591	missense	probably damaging	1.00
R4342:Nfasc	UTSW	1	132631705	missense	probably damaging	1.00
R4343:Nfasc	UTSW	1	132631705	missense	probably damaging	1.00
R4345:Nfasc	UTSW	1	132631705	missense	probably damaging	1.00
R4452:Nfasc	UTSW	1	132634671	missense	probably damaging	1.00
R4818:Nfasc	UTSW	1	132603830	missense	possibly damaging	0.87
R5014:Nfasc	UTSW	1	132584447	intron	probably benign
R5768:Nfasc	UTSW	1	132605145	missense	probably benign	0.00
R6145:Nfasc	UTSW	1	132634717	missense	probably damaging	1.00
R6335:Nfasc	UTSW	1	132576394	missense	probably damaging	0.98
R6379:Nfasc	UTSW	1	132570542	nonsense	probably null
R6486:Nfasc	UTSW	1	132605214	missense	probably damaging	1.00
R7022:Nfasc	UTSW	1	132621049	missense	probably damaging	1.00
R7062:Nfasc	UTSW	1	132601969	critical splice donor site	probably null
R7084:Nfasc	UTSW	1	132570509	missense	unknown
R7275:Nfasc	UTSW	1	132634263	missense	probably damaging	1.00
R7286:Nfasc	UTSW	1	132602052	missense	probably damaging	1.00
R7682:Nfasc	UTSW	1	132573773	missense	unknown
R7838:Nfasc	UTSW	1	132605549	missense	probably damaging	1.00
R7871:Nfasc	UTSW	1	132600013	missense	not run
R7938:Nfasc	UTSW	1	132605531	missense	probably damaging	1.00
R8083:Nfasc	UTSW	1	132596582	missense	probably benign	0.00
R8482:Nfasc	UTSW	1	132605089	missense	probably damaging	1.00
R9027:Nfasc	UTSW	1	132611605	missense	probably damaging	1.00
R9164:Nfasc	UTSW	1	132634806	missense	probably damaging	1.00
R9488:Nfasc	UTSW	1	132600128	missense	possibly damaging	0.68
R9651:Nfasc	UTSW	1	132600053	missense	probably benign	0.04
Z1176:Nfasc	UTSW	1	132634638	missense	probably benign	0.00
Z1177:Nfasc	UTSW	1	132631838	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCCTGACTGTTACCAGATG -3'
(R):5'- ACAGCCTATGAATGCTACCTCTG -3'

Sequencing Primer
(F):5'- ACTGTTACCAGATGTTGTAGAGCCC -3'
(R):5'- ATGAATGCTACCTCTGCCTTTGG -3'

Posted On

2016-03-01