Mutagenetix > Incidental Mutations

Incidental Mutation 'R4851:Ephb6'

373544

Institutional Source

Beutler Lab

Gene Symbol

Ephb6

Ensembl Gene

ENSMUSG00000029869

Gene Name

Eph receptor B6

Synonyms

Cekl, Mep

MMRRC Submission

042463-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.700) question?

Stock #

R4851 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41605482-41620509 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41618145 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 698 (W698R)

Ref Sequence

ENSEMBL: ENSMUSP00000110380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]

Predicted Effect

probably benign
Transcript: ENSMUST00000031902

SMART Domains

Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868

Domain	Start	End	E-Value	Type
ANK	44	74	2.39e2	SMART
ANK	78	107	6.17e-1	SMART
ANK	116	145	3.06e-5	SMART
ANK	162	191	1.85e-4	SMART
Blast:ANK	195	223	3e-10	BLAST
ANK	238	267	2.47e2	SMART
Pfam:Ion_trans	327	589	9.8e-18	PFAM
low complexity region	680	695	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114732
AA Change: W698R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: W698R

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
EPH_lbd	34	227	2.18e-100	SMART
low complexity region	242	255	N/A	INTRINSIC
Pfam:GCC2_GCC3	299	341	1.9e-9	PFAM
FN3	365	462	3.59e-3	SMART
FN3	481	562	3.73e-10	SMART
Pfam:EphA2_TM	589	660	3.4e-16	PFAM
Pfam:Pkinase	663	908	1.4e-29	PFAM
Pfam:Pkinase_Tyr	663	908	1.1e-67	PFAM
SAM	938	1005	1e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167082

Predicted Effect

probably benign
Transcript: ENSMUST00000167497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170624

Predicted Effect

probably benign
Transcript: ENSMUST00000201471

SMART Domains

Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868

Domain	Start	End	E-Value	Type
ANK	44	74	2.39e2	SMART
ANK	78	107	6.17e-1	SMART
ANK	116	145	3.06e-5	SMART
ANK	162	191	1.85e-4	SMART
Blast:ANK	195	223	3e-10	BLAST
ANK	238	267	2.47e2	SMART
Pfam:Ion_trans	327	589	9.8e-18	PFAM
low complexity region	680	695	N/A	INTRINSIC

Meta Mutation Damage Score

0.1039

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (99/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930451G09Rik	A	G	16: 4,976,274		noncoding transcript	Het
Abca13	A	T	11: 9,483,890	R4148S	probably benign	Het
Acoxl	T	A	2: 128,044,391	L182Q	possibly damaging	Het
Aldh7a1	T	C	18: 56,532,016	T364A	possibly damaging	Het
App	T	C	16: 85,056,434	D252G	unknown	Het
Arid1a	A	G	4: 133,681,361	I1945T	unknown	Het
Arsk	C	T	13: 76,065,279		probably null	Het
Atad2b	G	A	12: 4,943,251	G257S	probably benign	Het
Best1	C	A	19: 9,991,698	R218L	probably damaging	Het
Cacna1e	A	T	1: 154,436,554		probably null	Het
Cdh13	C	T	8: 118,757,390	T130I	possibly damaging	Het
Cela2a	T	C	4: 141,825,591	E25G	probably benign	Het
Cgnl1	T	A	9: 71,725,032	I346F	probably damaging	Het
Chil6	C	T	3: 106,389,928	G299D	possibly damaging	Het
Cic	G	A	7: 25,272,902	R686H	probably damaging	Het
Cnpy1	T	C	5: 28,245,740	I23V	probably benign	Het
Col6a3	T	A	1: 90,779,289	Y2034F	unknown	Het
Coq10b	T	C	1: 55,071,744	Y224H	probably benign	Het
Cryge	G	T	1: 65,051,052		probably benign	Het
Cyb5rl	T	G	4: 107,084,313	S252A	probably benign	Het
Cyp2ab1	T	A	16: 20,315,064	R125S	probably damaging	Het
Dclk1	G	A	3: 55,480,390	G86R	probably damaging	Het
Dmtn	A	G	14: 70,604,814	M382T	probably damaging	Het
Dnah12	T	A	14: 26,716,629	L471*	probably null	Het
Dock10	A	T	1: 80,549,157	S782T	probably benign	Het
Egfem1	C	A	3: 29,151,883	H90N	possibly damaging	Het
Exoc4	T	A	6: 33,918,408	C787S	probably damaging	Het
Exosc8	A	T	3: 54,732,102		probably benign	Het
Galc	T	A	12: 98,227,274	Q352L	probably benign	Het
Galns	A	G	8: 122,600,533	Y167H	probably damaging	Het
Glb1l	T	C	1: 75,208,884		probably benign	Het
Gm6185	A	T	1: 161,206,180		noncoding transcript	Het
Gm7694	T	C	1: 170,301,225	N245S	probably benign	Het
Gmcl1	T	G	6: 86,704,556	K385N	possibly damaging	Het
Gramd1c	A	T	16: 43,989,837	W463R	probably damaging	Het
Gtpbp8	C	G	16: 44,746,070	A90P	probably benign	Het
Hcar1	T	C	5: 123,878,668	E320G	probably benign	Het
Hhatl	T	C	9: 121,789,011	D226G	probably damaging	Het
Hist1h2bj	G	T	13: 22,043,251		probably benign	Het
Hoxc5	T	A	15: 103,015,369	I199N	probably damaging	Het
Iars2	T	C	1: 185,327,648	D121G	probably damaging	Het
Il5ra	T	A	6: 106,738,471	H134L	probably benign	Het
Isl2	T	A	9: 55,544,987	I281N	possibly damaging	Het
Kcnk13	T	C	12: 99,966,124	F60L	probably damaging	Het
Kdelr3	C	T	15: 79,524,865	T85M	possibly damaging	Het
Kdf1	A	T	4: 133,528,365	H131L	probably damaging	Het
Mipol1	T	A	12: 57,332,301	L182I	probably damaging	Het
Morc1	T	G	16: 48,561,617	S513R	probably benign	Het
Moxd2	A	T	6: 40,878,822	L611H	probably damaging	Het
Mpped2	T	C	2: 106,699,379		probably benign	Het
Mrpl51	T	C	6: 125,193,307	V92A	probably benign	Het
Mrps26	G	A	2: 130,563,761		probably benign	Het
Mrps5	A	G	2: 127,590,745	T29A	probably benign	Het
Mustn1	A	G	14: 30,879,560		probably benign	Het
Ncor2	G	A	5: 125,033,367	P858S	possibly damaging	Het
Nfasc	A	G	1: 132,602,021	F807S	probably damaging	Het
Nup50	G	A	15: 84,939,711	V422I	probably benign	Het
Olfr1044	T	A	2: 86,171,671	I49F	probably damaging	Het
Olfr1212	A	G	2: 88,958,586	N40S	probably damaging	Het
Olfr384	A	T	11: 73,603,057	H159L	probably damaging	Het
Olfr411	C	A	11: 74,346,943	V214L	probably benign	Het
Olfr417	T	A	1: 174,368,996	F26L	probably benign	Het
Olfr539	A	T	7: 140,667,313	M2L	probably benign	Het
Olfr695	A	T	7: 106,874,014	V77D	probably damaging	Het
Olfr907	T	A	9: 38,499,023	M118K	probably damaging	Het
Osbpl8	T	A	10: 111,204,800	M1K	probably null	Het
Pcdhb22	A	C	18: 37,519,034	D185A	possibly damaging	Het
Pcdhga8	G	T	18: 37,816,404	R291L	probably damaging	Het
Saysd1	A	T	14: 20,077,604	L84Q	possibly damaging	Het
Slc41a1	T	C	1: 131,830,770	I50T	probably benign	Het
Smg7	G	A	1: 152,844,269	P834S	probably benign	Het
Speer4a	C	T	5: 26,038,212	V92M	probably damaging	Het
Srf	T	C	17: 46,549,474	T461A	probably benign	Het
Ssu72	A	G	4: 155,715,596	D72G	possibly damaging	Het
Suco	T	C	1: 161,834,192	E890G	probably damaging	Het
Tenm3	A	G	8: 48,310,621		probably null	Het
Tm6sf1	A	G	7: 81,865,343	E7G	probably null	Het
Tm9sf2	A	G	14: 122,141,204	K240R	probably benign	Het
Tmem52	T	A	4: 155,470,368	Y149*	probably null	Het
Tpgs2	A	T	18: 25,151,248	Y68N	possibly damaging	Het
Vmn1r205	T	A	13: 22,592,904	E9D	probably benign	Het
Vmn2r32	A	G	7: 7,479,954	V7A	possibly damaging	Het
Vmn2r80	T	C	10: 79,194,322	Y661H	possibly damaging	Het
Vps39	G	A	2: 120,321,831		probably benign	Het
Vwde	A	T	6: 13,196,048	V326D	possibly damaging	Het
Zfp641	T	A	15: 98,288,717	S342C	probably damaging	Het
Zfp961	T	C	8: 71,969,003		probably benign	Het

Other mutations in Ephb6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Ephb6	APN	6	41615911	unclassified	probably benign
IGL01691:Ephb6	APN	6	41614515	missense	probably benign	0.26
IGL02052:Ephb6	APN	6	41613322	missense	probably benign
IGL02079:Ephb6	APN	6	41616014	missense	possibly damaging	0.57
IGL03089:Ephb6	APN	6	41614174	missense	probably damaging	1.00
P4748:Ephb6	UTSW	6	41617285	missense	probably damaging	0.96
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0974:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1610:Ephb6	UTSW	6	41614373	nonsense	probably null
R1658:Ephb6	UTSW	6	41614245	missense	probably damaging	1.00
R1687:Ephb6	UTSW	6	41617366	missense	probably benign	0.08
R1733:Ephb6	UTSW	6	41619720	missense	probably benign	0.10
R2191:Ephb6	UTSW	6	41616085	missense	possibly damaging	0.82
R2439:Ephb6	UTSW	6	41618735	missense	probably benign	0.31
R2915:Ephb6	UTSW	6	41614238	missense	probably damaging	1.00
R3020:Ephb6	UTSW	6	41614521	missense	probably damaging	1.00
R3499:Ephb6	UTSW	6	41616159	nonsense	probably null
R4606:Ephb6	UTSW	6	41616574	missense	probably benign	0.15
R4663:Ephb6	UTSW	6	41617865	missense	probably damaging	1.00
R4668:Ephb6	UTSW	6	41614602	missense	possibly damaging	0.91
R4762:Ephb6	UTSW	6	41618160	missense	probably damaging	0.99
R4767:Ephb6	UTSW	6	41614185	missense	possibly damaging	0.81
R4780:Ephb6	UTSW	6	41616139	missense	probably damaging	1.00
R4846:Ephb6	UTSW	6	41616809	missense	probably benign
R5016:Ephb6	UTSW	6	41618107	missense	probably benign	0.01
R5122:Ephb6	UTSW	6	41613404	missense	probably benign	0.00
R5313:Ephb6	UTSW	6	41616793	missense	possibly damaging	0.68
R5615:Ephb6	UTSW	6	41619291	missense	probably benign
R5623:Ephb6	UTSW	6	41616481	missense	probably benign	0.20
R5686:Ephb6	UTSW	6	41619704	missense	possibly damaging	0.57
R5840:Ephb6	UTSW	6	41615573	missense	possibly damaging	0.94
R6147:Ephb6	UTSW	6	41616781	missense	probably damaging	1.00
R6645:Ephb6	UTSW	6	41617272	missense	probably benign	0.01
R6730:Ephb6	UTSW	6	41617374	nonsense	probably null
R7412:Ephb6	UTSW	6	41620239	missense	probably damaging	1.00
R7442:Ephb6	UTSW	6	41618047	splice site	probably null
R7759:Ephb6	UTSW	6	41614605	missense	probably benign	0.00
R7857:Ephb6	UTSW	6	41613397	missense	probably benign
R8425:Ephb6	UTSW	6	41618646	missense	probably damaging	0.98
X0027:Ephb6	UTSW	6	41620080	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- AGAGCTTGCTCGAGAGGTTG -3'
(R):5'- GACCCTAAGAAAGCTGTCCAGG -3'

Sequencing Primer
(F):5'- CTCGAGAGGTTGACCCTACATATATC -3'
(R):5'- GGGACCAAGTTCCATGAGTTC -3'

Posted On

2016-03-01