Mutagenetix > Incidental Mutations

Incidental Mutation 'R4851:Kdelr3'

373578

Institutional Source

Beutler Lab

Gene Symbol

Kdelr3

Ensembl Gene

ENSMUSG00000010830

Gene Name

KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3

Synonyms

MMRRC Submission

042463-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.155) question?

Stock #

R4851 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79516411-79527739 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 79524865 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 85 (T85M)

Ref Sequence

ENSEMBL: ENSMUSP00000010974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010974] [ENSMUST00000054014] [ENSMUST00000229877]

AlphaFold

Q8R1L4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000010974
AA Change: T85M

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000010974
Gene: ENSMUSG00000010830
AA Change: T85M

Domain	Start	End	E-Value	Type
Pfam:ER_lumen_recept	28	169	3.3e-54	PFAM
transmembrane domain	179	200	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000054014

SMART Domains

Protein: ENSMUSP00000055535
Gene: ENSMUSG00000055065

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
Blast:DEXDc	29	87	7e-18	BLAST
DEXDc	111	314	4.79e-65	SMART
HELICc	353	434	3.34e-32	SMART
low complexity region	477	486	N/A	INTRINSIC
low complexity region	550	576	N/A	INTRINSIC
low complexity region	578	611	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229877

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (99/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KDEL endoplasmic reticulum protein retention receptor family. Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR3 was the third member of the family to be identified. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930451G09Rik	A	G	16: 4,976,274		noncoding transcript	Het
Abca13	A	T	11: 9,483,890	R4148S	probably benign	Het
Acoxl	T	A	2: 128,044,391	L182Q	possibly damaging	Het
Aldh7a1	T	C	18: 56,532,016	T364A	possibly damaging	Het
App	T	C	16: 85,056,434	D252G	unknown	Het
Arid1a	A	G	4: 133,681,361	I1945T	unknown	Het
Arsk	C	T	13: 76,065,279		probably null	Het
Atad2b	G	A	12: 4,943,251	G257S	probably benign	Het
Best1	C	A	19: 9,991,698	R218L	probably damaging	Het
Cacna1e	A	T	1: 154,436,554		probably null	Het
Cdh13	C	T	8: 118,757,390	T130I	possibly damaging	Het
Cela2a	T	C	4: 141,825,591	E25G	probably benign	Het
Cgnl1	T	A	9: 71,725,032	I346F	probably damaging	Het
Chil6	C	T	3: 106,389,928	G299D	possibly damaging	Het
Cic	G	A	7: 25,272,902	R686H	probably damaging	Het
Cnpy1	T	C	5: 28,245,740	I23V	probably benign	Het
Col6a3	T	A	1: 90,779,289	Y2034F	unknown	Het
Coq10b	T	C	1: 55,071,744	Y224H	probably benign	Het
Cryge	G	T	1: 65,051,052		probably benign	Het
Cyb5rl	T	G	4: 107,084,313	S252A	probably benign	Het
Cyp2ab1	T	A	16: 20,315,064	R125S	probably damaging	Het
Dclk1	G	A	3: 55,480,390	G86R	probably damaging	Het
Dmtn	A	G	14: 70,604,814	M382T	probably damaging	Het
Dnah12	T	A	14: 26,716,629	L471*	probably null	Het
Dock10	A	T	1: 80,549,157	S782T	probably benign	Het
Egfem1	C	A	3: 29,151,883	H90N	possibly damaging	Het
Ephb6	T	A	6: 41,618,145	W698R	probably benign	Het
Exoc4	T	A	6: 33,918,408	C787S	probably damaging	Het
Exosc8	A	T	3: 54,732,102		probably benign	Het
Galc	T	A	12: 98,227,274	Q352L	probably benign	Het
Galns	A	G	8: 122,600,533	Y167H	probably damaging	Het
Glb1l	T	C	1: 75,208,884		probably benign	Het
Gm6185	A	T	1: 161,206,180		noncoding transcript	Het
Gm7694	T	C	1: 170,301,225	N245S	probably benign	Het
Gmcl1	T	G	6: 86,704,556	K385N	possibly damaging	Het
Gramd1c	A	T	16: 43,989,837	W463R	probably damaging	Het
Gtpbp8	C	G	16: 44,746,070	A90P	probably benign	Het
Hcar1	T	C	5: 123,878,668	E320G	probably benign	Het
Hhatl	T	C	9: 121,789,011	D226G	probably damaging	Het
Hist1h2bj	G	T	13: 22,043,251		probably benign	Het
Hoxc5	T	A	15: 103,015,369	I199N	probably damaging	Het
Iars2	T	C	1: 185,327,648	D121G	probably damaging	Het
Il5ra	T	A	6: 106,738,471	H134L	probably benign	Het
Isl2	T	A	9: 55,544,987	I281N	possibly damaging	Het
Kcnk13	T	C	12: 99,966,124	F60L	probably damaging	Het
Kdf1	A	T	4: 133,528,365	H131L	probably damaging	Het
Mipol1	T	A	12: 57,332,301	L182I	probably damaging	Het
Morc1	T	G	16: 48,561,617	S513R	probably benign	Het
Moxd2	A	T	6: 40,878,822	L611H	probably damaging	Het
Mpped2	T	C	2: 106,699,379		probably benign	Het
Mrpl51	T	C	6: 125,193,307	V92A	probably benign	Het
Mrps26	G	A	2: 130,563,761		probably benign	Het
Mrps5	A	G	2: 127,590,745	T29A	probably benign	Het
Mustn1	A	G	14: 30,879,560		probably benign	Het
Ncor2	G	A	5: 125,033,367	P858S	possibly damaging	Het
Nfasc	A	G	1: 132,602,021	F807S	probably damaging	Het
Nup50	G	A	15: 84,939,711	V422I	probably benign	Het
Olfr1044	T	A	2: 86,171,671	I49F	probably damaging	Het
Olfr1212	A	G	2: 88,958,586	N40S	probably damaging	Het
Olfr384	A	T	11: 73,603,057	H159L	probably damaging	Het
Olfr411	C	A	11: 74,346,943	V214L	probably benign	Het
Olfr417	T	A	1: 174,368,996	F26L	probably benign	Het
Olfr539	A	T	7: 140,667,313	M2L	probably benign	Het
Olfr695	A	T	7: 106,874,014	V77D	probably damaging	Het
Olfr907	T	A	9: 38,499,023	M118K	probably damaging	Het
Osbpl8	T	A	10: 111,204,800	M1K	probably null	Het
Pcdhb22	A	C	18: 37,519,034	D185A	possibly damaging	Het
Pcdhga8	G	T	18: 37,816,404	R291L	probably damaging	Het
Saysd1	A	T	14: 20,077,604	L84Q	possibly damaging	Het
Slc41a1	T	C	1: 131,830,770	I50T	probably benign	Het
Smg7	G	A	1: 152,844,269	P834S	probably benign	Het
Speer4a	C	T	5: 26,038,212	V92M	probably damaging	Het
Srf	T	C	17: 46,549,474	T461A	probably benign	Het
Ssu72	A	G	4: 155,715,596	D72G	possibly damaging	Het
Suco	T	C	1: 161,834,192	E890G	probably damaging	Het
Tenm3	A	G	8: 48,310,621		probably null	Het
Tm6sf1	A	G	7: 81,865,343	E7G	probably null	Het
Tm9sf2	A	G	14: 122,141,204	K240R	probably benign	Het
Tmem52	T	A	4: 155,470,368	Y149*	probably null	Het
Tpgs2	A	T	18: 25,151,248	Y68N	possibly damaging	Het
Vmn1r205	T	A	13: 22,592,904	E9D	probably benign	Het
Vmn2r32	A	G	7: 7,479,954	V7A	possibly damaging	Het
Vmn2r80	T	C	10: 79,194,322	Y661H	possibly damaging	Het
Vps39	G	A	2: 120,321,831		probably benign	Het
Vwde	A	T	6: 13,196,048	V326D	possibly damaging	Het
Zfp641	T	A	15: 98,288,717	S342C	probably damaging	Het
Zfp961	T	C	8: 71,969,003		probably benign	Het

Other mutations in Kdelr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01486:Kdelr3	APN	15	79522847	missense	probably damaging	1.00
IGL01772:Kdelr3	APN	15	79522920	unclassified	probably benign
IGL02437:Kdelr3	APN	15	79525787	missense	probably damaging	1.00
R1581:Kdelr3	UTSW	15	79522913	critical splice donor site	probably null
R2567:Kdelr3	UTSW	15	79522831	missense	probably benign
R5376:Kdelr3	UTSW	15	79525860	missense	possibly damaging	0.93
R5696:Kdelr3	UTSW	15	79525899	splice site	probably null
R7407:Kdelr3	UTSW	15	79524838	missense	probably damaging	0.99
R8811:Kdelr3	UTSW	15	79525851	missense	possibly damaging	0.46
R8871:Kdelr3	UTSW	15	79525843	nonsense	probably null
R9297:Kdelr3	UTSW	15	79527074	missense	probably benign	0.00
R9318:Kdelr3	UTSW	15	79527074	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCAACTCGTGACTCTAGGG -3'
(R):5'- GGCTCATGGTAGAAATGCCC -3'

Sequencing Primer
(F):5'- TAGGGGCCCCAGAAACATCATG -3'
(R):5'- CTCATGGTAGAAATGCCCAGATG -3'

Posted On

2016-03-01