Incidental Mutation 'R4851:Hoxc5'
ID373581
Institutional Source Beutler Lab
Gene Symbol Hoxc5
Ensembl Gene ENSMUSG00000022485
Gene Namehomeobox C5
SynonymsHox-3.4, Hox-6.2
MMRRC Submission 042463-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R4851 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102967443-103017429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103015369 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 199 (I199N)
Ref Sequence ENSEMBL: ENSMUSP00000001709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001709] [ENSMUST00000001711] [ENSMUST00000165375]
Predicted Effect probably damaging
Transcript: ENSMUST00000001709
AA Change: I199N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001709
Gene: ENSMUSG00000022485
AA Change: I199N

DomainStartEndE-ValueType
low complexity region 69 85 N/A INTRINSIC
HOX 155 217 3.03e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000001711
SMART Domains Protein: ENSMUSP00000001711
Gene: ENSMUSG00000001661

DomainStartEndE-ValueType
HOX 141 203 2.39e-24 SMART
low complexity region 221 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102056
Predicted Effect probably benign
Transcript: ENSMUST00000165375
SMART Domains Protein: ENSMUSP00000133561
Gene: ENSMUSG00000075394

DomainStartEndE-ValueType
low complexity region 46 68 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174869
Meta Mutation Damage Score 0.9141 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC5, is one of several homeobox HOXC genes located in a cluster on chromosome 12. Three genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include the shared exon spliced to the gene-specific exons, or they may include only the gene-specific exons. Two alternatively spliced variants have been described for HOXC5. The transcript variant which includes the shared exon apparently doesn't encode a protein. The protein-coding transcript variant contains gene-specific exons only. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik A G 16: 4,976,274 noncoding transcript Het
Abca13 A T 11: 9,483,890 R4148S probably benign Het
Acoxl T A 2: 128,044,391 L182Q possibly damaging Het
Aldh7a1 T C 18: 56,532,016 T364A possibly damaging Het
App T C 16: 85,056,434 D252G unknown Het
Arid1a A G 4: 133,681,361 I1945T unknown Het
Arsk C T 13: 76,065,279 probably null Het
Atad2b G A 12: 4,943,251 G257S probably benign Het
Best1 C A 19: 9,991,698 R218L probably damaging Het
Cacna1e A T 1: 154,436,554 probably null Het
Cdh13 C T 8: 118,757,390 T130I possibly damaging Het
Cela2a T C 4: 141,825,591 E25G probably benign Het
Cgnl1 T A 9: 71,725,032 I346F probably damaging Het
Chil6 C T 3: 106,389,928 G299D possibly damaging Het
Cic G A 7: 25,272,902 R686H probably damaging Het
Cnpy1 T C 5: 28,245,740 I23V probably benign Het
Col6a3 T A 1: 90,779,289 Y2034F unknown Het
Coq10b T C 1: 55,071,744 Y224H probably benign Het
Cryge G T 1: 65,051,052 probably benign Het
Cyb5rl T G 4: 107,084,313 S252A probably benign Het
Cyp2ab1 T A 16: 20,315,064 R125S probably damaging Het
Dclk1 G A 3: 55,480,390 G86R probably damaging Het
Dmtn A G 14: 70,604,814 M382T probably damaging Het
Dnah12 T A 14: 26,716,629 L471* probably null Het
Dock10 A T 1: 80,549,157 S782T probably benign Het
Egfem1 C A 3: 29,151,883 H90N possibly damaging Het
Ephb6 T A 6: 41,618,145 W698R probably benign Het
Exoc4 T A 6: 33,918,408 C787S probably damaging Het
Exosc8 A T 3: 54,732,102 probably benign Het
Galc T A 12: 98,227,274 Q352L probably benign Het
Galns A G 8: 122,600,533 Y167H probably damaging Het
Glb1l T C 1: 75,208,884 probably benign Het
Gm6185 A T 1: 161,206,180 noncoding transcript Het
Gm7694 T C 1: 170,301,225 N245S probably benign Het
Gmcl1 T G 6: 86,704,556 K385N possibly damaging Het
Gramd1c A T 16: 43,989,837 W463R probably damaging Het
Gtpbp8 C G 16: 44,746,070 A90P probably benign Het
Hcar1 T C 5: 123,878,668 E320G probably benign Het
Hhatl T C 9: 121,789,011 D226G probably damaging Het
Hist1h2bj G T 13: 22,043,251 probably benign Het
Iars2 T C 1: 185,327,648 D121G probably damaging Het
Il5ra T A 6: 106,738,471 H134L probably benign Het
Isl2 T A 9: 55,544,987 I281N possibly damaging Het
Kcnk13 T C 12: 99,966,124 F60L probably damaging Het
Kdelr3 C T 15: 79,524,865 T85M possibly damaging Het
Kdf1 A T 4: 133,528,365 H131L probably damaging Het
Mipol1 T A 12: 57,332,301 L182I probably damaging Het
Morc1 T G 16: 48,561,617 S513R probably benign Het
Moxd2 A T 6: 40,878,822 L611H probably damaging Het
Mpped2 T C 2: 106,699,379 probably benign Het
Mrpl51 T C 6: 125,193,307 V92A probably benign Het
Mrps26 G A 2: 130,563,761 probably benign Het
Mrps5 A G 2: 127,590,745 T29A probably benign Het
Mustn1 A G 14: 30,879,560 probably benign Het
Ncor2 G A 5: 125,033,367 P858S possibly damaging Het
Nfasc A G 1: 132,602,021 F807S probably damaging Het
Nup50 G A 15: 84,939,711 V422I probably benign Het
Olfr1044 T A 2: 86,171,671 I49F probably damaging Het
Olfr1212 A G 2: 88,958,586 N40S probably damaging Het
Olfr384 A T 11: 73,603,057 H159L probably damaging Het
Olfr411 C A 11: 74,346,943 V214L probably benign Het
Olfr417 T A 1: 174,368,996 F26L probably benign Het
Olfr539 A T 7: 140,667,313 M2L probably benign Het
Olfr695 A T 7: 106,874,014 V77D probably damaging Het
Olfr907 T A 9: 38,499,023 M118K probably damaging Het
Osbpl8 T A 10: 111,204,800 M1K probably null Het
Pcdhb22 A C 18: 37,519,034 D185A possibly damaging Het
Pcdhga8 G T 18: 37,816,404 R291L probably damaging Het
Saysd1 A T 14: 20,077,604 L84Q possibly damaging Het
Slc41a1 T C 1: 131,830,770 I50T probably benign Het
Smg7 G A 1: 152,844,269 P834S probably benign Het
Speer4a C T 5: 26,038,212 V92M probably damaging Het
Srf T C 17: 46,549,474 T461A probably benign Het
Ssu72 A G 4: 155,715,596 D72G possibly damaging Het
Suco T C 1: 161,834,192 E890G probably damaging Het
Tenm3 A G 8: 48,310,621 probably null Het
Tm6sf1 A G 7: 81,865,343 E7G probably null Het
Tm9sf2 A G 14: 122,141,204 K240R probably benign Het
Tmem52 T A 4: 155,470,368 Y149* probably null Het
Tpgs2 A T 18: 25,151,248 Y68N possibly damaging Het
Vmn1r205 T A 13: 22,592,904 E9D probably benign Het
Vmn2r32 A G 7: 7,479,954 V7A possibly damaging Het
Vmn2r80 T C 10: 79,194,322 Y661H possibly damaging Het
Vps39 G A 2: 120,321,831 probably benign Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp641 T A 15: 98,288,717 S342C probably damaging Het
Zfp961 T C 8: 71,969,003 probably benign Het
Other mutations in Hoxc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03339:Hoxc5 APN 15 103014136 missense probably damaging 0.98
R0386:Hoxc5 UTSW 15 103015352 nonsense probably null
R1797:Hoxc5 UTSW 15 103014434 missense probably benign 0.00
R2021:Hoxc5 UTSW 15 103014382 splice site probably null
R4967:Hoxc5 UTSW 15 103015354 missense probably damaging 1.00
R5089:Hoxc5 UTSW 15 103014055 unclassified probably benign
R6718:Hoxc5 UTSW 15 103014266 splice site probably null
R6784:Hoxc5 UTSW 15 103013890 unclassified probably benign
R6927:Hoxc5 UTSW 15 103015375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTGCACGCTATTCATC -3'
(R):5'- AGAAATGCGCTTTTGTCTGG -3'

Sequencing Primer
(F):5'- ATTCATCCCTCCCTGGTTTGG -3'
(R):5'- CTTTTGTCTGGGAGGCCC -3'
Posted On2016-03-01