Incidental Mutation 'R4851:App'
ID 373587
Institutional Source Beutler Lab
Gene Symbol App
Ensembl Gene ENSMUSG00000022892
Gene Name amyloid beta (A4) precursor protein
Synonyms Adap, Abeta, protease nexin II, E030013M08Rik, betaAPP, appican, Cvap
MMRRC Submission 042463-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock # R4851 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 84949685-85173766 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85056434 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 252 (D252G)
Ref Sequence ENSEMBL: ENSMUSP00000154401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005406] [ENSMUST00000226232] [ENSMUST00000226801] [ENSMUST00000227021] [ENSMUST00000227723] [ENSMUST00000227737]
AlphaFold P12023
Predicted Effect unknown
Transcript: ENSMUST00000005406
AA Change: D252G
SMART Domains Protein: ENSMUSP00000005406
Gene: ENSMUSG00000022892
AA Change: D252G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
A4_EXTRA 24 188 5.33e-129 SMART
low complexity region 190 208 N/A INTRINSIC
Pfam:APP_E2 291 473 2.5e-77 PFAM
Pfam:Beta-APP 600 638 3.4e-28 PFAM
Pfam:APP_amyloid 641 691 8.6e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000226232
AA Change: D252G
Predicted Effect unknown
Transcript: ENSMUST00000226801
AA Change: D252G
Predicted Effect unknown
Transcript: ENSMUST00000227021
AA Change: D252G
Predicted Effect unknown
Transcript: ENSMUST00000227723
AA Change: D252G
Predicted Effect unknown
Transcript: ENSMUST00000227737
AA Change: D252G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227990
Meta Mutation Damage Score 0.0621 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor and transmembrane precursor protein that is cleaved by secretases to form a number of peptides. Some of these peptides are secreted and can bind to the acetyltransferase complex APBB1/TIP60 to promote transcriptional activation, while others form the protein basis of the amyloid plaques found in the brains of patients with Alzheimer disease. In addition, two of the peptides are antimicrobial peptides, having been shown to have bacteriocidal and antifungal activities. Mutations in this gene have been implicated in autosomal dominant Alzheimer disease and cerebroarterial amyloidosis (cerebral amyloid angiopathy). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced body weight, brain weight, size of forebrain commissures, locomotor activity, forelimb grip strength, and spatial learning scores. Many mice also exhibit agenesis of the corpus callosum, and extensive reactive gliosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik A G 16: 4,976,274 noncoding transcript Het
Abca13 A T 11: 9,483,890 R4148S probably benign Het
Acoxl T A 2: 128,044,391 L182Q possibly damaging Het
Aldh7a1 T C 18: 56,532,016 T364A possibly damaging Het
Arid1a A G 4: 133,681,361 I1945T unknown Het
Arsk C T 13: 76,065,279 probably null Het
Atad2b G A 12: 4,943,251 G257S probably benign Het
Best1 C A 19: 9,991,698 R218L probably damaging Het
Cacna1e A T 1: 154,436,554 probably null Het
Cdh13 C T 8: 118,757,390 T130I possibly damaging Het
Cela2a T C 4: 141,825,591 E25G probably benign Het
Cgnl1 T A 9: 71,725,032 I346F probably damaging Het
Chil6 C T 3: 106,389,928 G299D possibly damaging Het
Cic G A 7: 25,272,902 R686H probably damaging Het
Cnpy1 T C 5: 28,245,740 I23V probably benign Het
Col6a3 T A 1: 90,779,289 Y2034F unknown Het
Coq10b T C 1: 55,071,744 Y224H probably benign Het
Cryge G T 1: 65,051,052 probably benign Het
Cyb5rl T G 4: 107,084,313 S252A probably benign Het
Cyp2ab1 T A 16: 20,315,064 R125S probably damaging Het
Dclk1 G A 3: 55,480,390 G86R probably damaging Het
Dmtn A G 14: 70,604,814 M382T probably damaging Het
Dnah12 T A 14: 26,716,629 L471* probably null Het
Dock10 A T 1: 80,549,157 S782T probably benign Het
Egfem1 C A 3: 29,151,883 H90N possibly damaging Het
Ephb6 T A 6: 41,618,145 W698R probably benign Het
Exoc4 T A 6: 33,918,408 C787S probably damaging Het
Exosc8 A T 3: 54,732,102 probably benign Het
Galc T A 12: 98,227,274 Q352L probably benign Het
Galns A G 8: 122,600,533 Y167H probably damaging Het
Glb1l T C 1: 75,208,884 probably benign Het
Gm6185 A T 1: 161,206,180 noncoding transcript Het
Gm7694 T C 1: 170,301,225 N245S probably benign Het
Gmcl1 T G 6: 86,704,556 K385N possibly damaging Het
Gramd1c A T 16: 43,989,837 W463R probably damaging Het
Gtpbp8 C G 16: 44,746,070 A90P probably benign Het
Hcar1 T C 5: 123,878,668 E320G probably benign Het
Hhatl T C 9: 121,789,011 D226G probably damaging Het
Hist1h2bj G T 13: 22,043,251 probably benign Het
Hoxc5 T A 15: 103,015,369 I199N probably damaging Het
Iars2 T C 1: 185,327,648 D121G probably damaging Het
Il5ra T A 6: 106,738,471 H134L probably benign Het
Isl2 T A 9: 55,544,987 I281N possibly damaging Het
Kcnk13 T C 12: 99,966,124 F60L probably damaging Het
Kdelr3 C T 15: 79,524,865 T85M possibly damaging Het
Kdf1 A T 4: 133,528,365 H131L probably damaging Het
Mipol1 T A 12: 57,332,301 L182I probably damaging Het
Morc1 T G 16: 48,561,617 S513R probably benign Het
Moxd2 A T 6: 40,878,822 L611H probably damaging Het
Mpped2 T C 2: 106,699,379 probably benign Het
Mrpl51 T C 6: 125,193,307 V92A probably benign Het
Mrps26 G A 2: 130,563,761 probably benign Het
Mrps5 A G 2: 127,590,745 T29A probably benign Het
Mustn1 A G 14: 30,879,560 probably benign Het
Ncor2 G A 5: 125,033,367 P858S possibly damaging Het
Nfasc A G 1: 132,602,021 F807S probably damaging Het
Nup50 G A 15: 84,939,711 V422I probably benign Het
Olfr1044 T A 2: 86,171,671 I49F probably damaging Het
Olfr1212 A G 2: 88,958,586 N40S probably damaging Het
Olfr384 A T 11: 73,603,057 H159L probably damaging Het
Olfr411 C A 11: 74,346,943 V214L probably benign Het
Olfr417 T A 1: 174,368,996 F26L probably benign Het
Olfr539 A T 7: 140,667,313 M2L probably benign Het
Olfr695 A T 7: 106,874,014 V77D probably damaging Het
Olfr907 T A 9: 38,499,023 M118K probably damaging Het
Osbpl8 T A 10: 111,204,800 M1K probably null Het
Pcdhb22 A C 18: 37,519,034 D185A possibly damaging Het
Pcdhga8 G T 18: 37,816,404 R291L probably damaging Het
Saysd1 A T 14: 20,077,604 L84Q possibly damaging Het
Slc41a1 T C 1: 131,830,770 I50T probably benign Het
Smg7 G A 1: 152,844,269 P834S probably benign Het
Speer4a C T 5: 26,038,212 V92M probably damaging Het
Srf T C 17: 46,549,474 T461A probably benign Het
Ssu72 A G 4: 155,715,596 D72G possibly damaging Het
Suco T C 1: 161,834,192 E890G probably damaging Het
Tenm3 A G 8: 48,310,621 probably null Het
Tm6sf1 A G 7: 81,865,343 E7G probably null Het
Tm9sf2 A G 14: 122,141,204 K240R probably benign Het
Tmem52 T A 4: 155,470,368 Y149* probably null Het
Tpgs2 A T 18: 25,151,248 Y68N possibly damaging Het
Vmn1r205 T A 13: 22,592,904 E9D probably benign Het
Vmn2r32 A G 7: 7,479,954 V7A possibly damaging Het
Vmn2r80 T C 10: 79,194,322 Y661H possibly damaging Het
Vps39 G A 2: 120,321,831 probably benign Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp641 T A 15: 98,288,717 S342C probably damaging Het
Zfp961 T C 8: 71,969,003 probably benign Het
Other mutations in App
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:App APN 16 84965711 missense probably damaging 0.99
IGL01457:App APN 16 85103239 missense probably damaging 1.00
IGL02016:App APN 16 85056521 missense unknown
IGL02135:App APN 16 85079838 critical splice donor site probably null
IGL02338:App APN 16 85173519 missense probably benign 0.01
IGL02377:App APN 16 85082831 missense probably benign 0.07
IGL02516:App APN 16 84955417 missense probably damaging 1.00
IGL02565:App APN 16 85025420 splice site probably null
IGL03179:App APN 16 85082847 missense probably damaging 1.00
BB005:App UTSW 16 84978246 missense probably benign 0.05
BB015:App UTSW 16 84978246 missense probably benign 0.05
LCD18:App UTSW 16 85025412 splice site probably benign
R0349:App UTSW 16 85013680 missense probably damaging 1.00
R0440:App UTSW 16 85056414 nonsense probably null
R0515:App UTSW 16 85103344 splice site probably benign
R0730:App UTSW 16 85079952 missense probably damaging 0.98
R1609:App UTSW 16 85079949 missense probably damaging 0.97
R1703:App UTSW 16 84965768 missense probably damaging 1.00
R2516:App UTSW 16 84978229 missense probably damaging 0.97
R4366:App UTSW 16 85056433 missense unknown
R4735:App UTSW 16 85103314 missense probably damaging 0.99
R4849:App UTSW 16 85056434 missense unknown
R6254:App UTSW 16 84978177 missense probably damaging 1.00
R6489:App UTSW 16 85056520 missense unknown
R6796:App UTSW 16 85120567 missense probably damaging 0.98
R7132:App UTSW 16 85056482 missense unknown
R7194:App UTSW 16 85025431 missense probably benign 0.40
R7456:App UTSW 16 85173560
R7528:App UTSW 16 84978258 missense possibly damaging 0.89
R7594:App UTSW 16 85080002 missense unknown
R7699:App UTSW 16 85040309 critical splice acceptor site probably null
R7700:App UTSW 16 85040309 critical splice acceptor site probably null
R7928:App UTSW 16 84978246 missense probably benign 0.05
R8086:App UTSW 16 85120540 missense unknown
R8346:App UTSW 16 85103257 missense unknown
R8506:App UTSW 16 85082816 missense unknown
R8902:App UTSW 16 85079879 missense unknown
R9142:App UTSW 16 85103239 missense probably damaging 1.00
R9244:App UTSW 16 84962741 missense probably damaging 0.99
Z1176:App UTSW 16 85024917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGAAGCCTTGTGATTTTG -3'
(R):5'- CACGCATTACCAAAGTCCCTTG -3'

Sequencing Primer
(F):5'- CTGGAGAAGGGAAGCACTGATTG -3'
(R):5'- ACCAAAGTCCCTTGATTCTTTTTC -3'
Posted On 2016-03-01