Incidental Mutation 'R4851:Pcdhb22'
ID 373591
Institutional Source Beutler Lab
Gene Symbol Pcdhb22
Ensembl Gene ENSMUSG00000073591
Gene Name protocadherin beta 22
Synonyms PcdhbV, Pcdhb15
MMRRC Submission 042463-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4851 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 37517871-37524479 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 37519034 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 185 (D185A)
Ref Sequence ENSEMBL: ENSMUSP00000141521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061405] [ENSMUST00000097609] [ENSMUST00000115661] [ENSMUST00000192409] [ENSMUST00000194544]
AlphaFold Q91XZ8
Predicted Effect probably benign
Transcript: ENSMUST00000061405
SMART Domains Protein: ENSMUSP00000056424
Gene: ENSMUSG00000044022

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Cadherin_2 30 110 4.2e-30 PFAM
CA 153 238 1.8e-17 SMART
CA 262 343 1.54e-25 SMART
CA 367 448 1.03e-21 SMART
CA 472 558 3.41e-27 SMART
CA 588 669 1.54e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097609
SMART Domains Protein: ENSMUSP00000095214
Gene: ENSMUSG00000073591

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 28 110 5.8e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
Pfam:Cadherin_C_2 685 768 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192409
AA Change: D185A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141521
Gene: ENSMUSG00000073591
AA Change: D185A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cadherin_2 27 110 2.5e-32 PFAM
CA 153 238 3.99e-19 SMART
CA 262 343 2.18e-25 SMART
CA 366 447 1.53e-20 SMART
CA 471 557 3.6e-26 SMART
CA 587 668 5.35e-11 SMART
transmembrane domain 689 711 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.3295 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik A G 16: 4,976,274 noncoding transcript Het
Abca13 A T 11: 9,483,890 R4148S probably benign Het
Acoxl T A 2: 128,044,391 L182Q possibly damaging Het
Aldh7a1 T C 18: 56,532,016 T364A possibly damaging Het
App T C 16: 85,056,434 D252G unknown Het
Arid1a A G 4: 133,681,361 I1945T unknown Het
Arsk C T 13: 76,065,279 probably null Het
Atad2b G A 12: 4,943,251 G257S probably benign Het
Best1 C A 19: 9,991,698 R218L probably damaging Het
Cacna1e A T 1: 154,436,554 probably null Het
Cdh13 C T 8: 118,757,390 T130I possibly damaging Het
Cela2a T C 4: 141,825,591 E25G probably benign Het
Cgnl1 T A 9: 71,725,032 I346F probably damaging Het
Chil6 C T 3: 106,389,928 G299D possibly damaging Het
Cic G A 7: 25,272,902 R686H probably damaging Het
Cnpy1 T C 5: 28,245,740 I23V probably benign Het
Col6a3 T A 1: 90,779,289 Y2034F unknown Het
Coq10b T C 1: 55,071,744 Y224H probably benign Het
Cryge G T 1: 65,051,052 probably benign Het
Cyb5rl T G 4: 107,084,313 S252A probably benign Het
Cyp2ab1 T A 16: 20,315,064 R125S probably damaging Het
Dclk1 G A 3: 55,480,390 G86R probably damaging Het
Dmtn A G 14: 70,604,814 M382T probably damaging Het
Dnah12 T A 14: 26,716,629 L471* probably null Het
Dock10 A T 1: 80,549,157 S782T probably benign Het
Egfem1 C A 3: 29,151,883 H90N possibly damaging Het
Ephb6 T A 6: 41,618,145 W698R probably benign Het
Exoc4 T A 6: 33,918,408 C787S probably damaging Het
Exosc8 A T 3: 54,732,102 probably benign Het
Galc T A 12: 98,227,274 Q352L probably benign Het
Galns A G 8: 122,600,533 Y167H probably damaging Het
Glb1l T C 1: 75,208,884 probably benign Het
Gm6185 A T 1: 161,206,180 noncoding transcript Het
Gm7694 T C 1: 170,301,225 N245S probably benign Het
Gmcl1 T G 6: 86,704,556 K385N possibly damaging Het
Gramd1c A T 16: 43,989,837 W463R probably damaging Het
Gtpbp8 C G 16: 44,746,070 A90P probably benign Het
Hcar1 T C 5: 123,878,668 E320G probably benign Het
Hhatl T C 9: 121,789,011 D226G probably damaging Het
Hist1h2bj G T 13: 22,043,251 probably benign Het
Hoxc5 T A 15: 103,015,369 I199N probably damaging Het
Iars2 T C 1: 185,327,648 D121G probably damaging Het
Il5ra T A 6: 106,738,471 H134L probably benign Het
Isl2 T A 9: 55,544,987 I281N possibly damaging Het
Kcnk13 T C 12: 99,966,124 F60L probably damaging Het
Kdelr3 C T 15: 79,524,865 T85M possibly damaging Het
Kdf1 A T 4: 133,528,365 H131L probably damaging Het
Mipol1 T A 12: 57,332,301 L182I probably damaging Het
Morc1 T G 16: 48,561,617 S513R probably benign Het
Moxd2 A T 6: 40,878,822 L611H probably damaging Het
Mpped2 T C 2: 106,699,379 probably benign Het
Mrpl51 T C 6: 125,193,307 V92A probably benign Het
Mrps26 G A 2: 130,563,761 probably benign Het
Mrps5 A G 2: 127,590,745 T29A probably benign Het
Mustn1 A G 14: 30,879,560 probably benign Het
Ncor2 G A 5: 125,033,367 P858S possibly damaging Het
Nfasc A G 1: 132,602,021 F807S probably damaging Het
Nup50 G A 15: 84,939,711 V422I probably benign Het
Olfr1044 T A 2: 86,171,671 I49F probably damaging Het
Olfr1212 A G 2: 88,958,586 N40S probably damaging Het
Olfr384 A T 11: 73,603,057 H159L probably damaging Het
Olfr411 C A 11: 74,346,943 V214L probably benign Het
Olfr417 T A 1: 174,368,996 F26L probably benign Het
Olfr539 A T 7: 140,667,313 M2L probably benign Het
Olfr695 A T 7: 106,874,014 V77D probably damaging Het
Olfr907 T A 9: 38,499,023 M118K probably damaging Het
Osbpl8 T A 10: 111,204,800 M1K probably null Het
Pcdhga8 G T 18: 37,816,404 R291L probably damaging Het
Saysd1 A T 14: 20,077,604 L84Q possibly damaging Het
Slc41a1 T C 1: 131,830,770 I50T probably benign Het
Smg7 G A 1: 152,844,269 P834S probably benign Het
Speer4a C T 5: 26,038,212 V92M probably damaging Het
Srf T C 17: 46,549,474 T461A probably benign Het
Ssu72 A G 4: 155,715,596 D72G possibly damaging Het
Suco T C 1: 161,834,192 E890G probably damaging Het
Tenm3 A G 8: 48,310,621 probably null Het
Tm6sf1 A G 7: 81,865,343 E7G probably null Het
Tm9sf2 A G 14: 122,141,204 K240R probably benign Het
Tmem52 T A 4: 155,470,368 Y149* probably null Het
Tpgs2 A T 18: 25,151,248 Y68N possibly damaging Het
Vmn1r205 T A 13: 22,592,904 E9D probably benign Het
Vmn2r32 A G 7: 7,479,954 V7A possibly damaging Het
Vmn2r80 T C 10: 79,194,322 Y661H possibly damaging Het
Vps39 G A 2: 120,321,831 probably benign Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp641 T A 15: 98,288,717 S342C probably damaging Het
Zfp961 T C 8: 71,969,003 probably benign Het
Other mutations in Pcdhb22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pcdhb22 APN 18 37520132 missense probably damaging 1.00
IGL00775:Pcdhb22 APN 18 37519742 missense probably benign 0.09
IGL01414:Pcdhb22 APN 18 37519496 missense probably damaging 1.00
IGL01819:Pcdhb22 APN 18 37519921 missense probably damaging 1.00
IGL02232:Pcdhb22 APN 18 37520549 missense probably damaging 1.00
IGL03226:Pcdhb22 APN 18 37518956 missense probably damaging 1.00
timber UTSW 18 37519147 missense probably damaging 1.00
R0071:Pcdhb22 UTSW 18 37520078 missense probably damaging 1.00
R0363:Pcdhb22 UTSW 18 37519160 missense probably benign 0.01
R0454:Pcdhb22 UTSW 18 37518872 missense probably damaging 0.99
R0624:Pcdhb22 UTSW 18 37518727 missense probably benign 0.00
R0707:Pcdhb22 UTSW 18 37518851 missense probably damaging 1.00
R0918:Pcdhb22 UTSW 18 37520014 missense probably damaging 1.00
R1112:Pcdhb22 UTSW 18 37519768 missense possibly damaging 0.61
R1299:Pcdhb22 UTSW 18 37520590 missense probably damaging 0.99
R1351:Pcdhb22 UTSW 18 37518574 missense probably benign 0.10
R1488:Pcdhb22 UTSW 18 37519888 missense possibly damaging 0.79
R1595:Pcdhb22 UTSW 18 37520453 missense probably damaging 1.00
R1709:Pcdhb22 UTSW 18 37518500 missense probably benign 0.31
R1725:Pcdhb22 UTSW 18 37520188 missense probably benign 0.04
R1869:Pcdhb22 UTSW 18 37519147 missense probably damaging 1.00
R1871:Pcdhb22 UTSW 18 37519147 missense probably damaging 1.00
R1891:Pcdhb22 UTSW 18 37519304 missense probably damaging 0.97
R4523:Pcdhb22 UTSW 18 37520421 missense probably benign 0.05
R4825:Pcdhb22 UTSW 18 37520660 missense possibly damaging 0.80
R4831:Pcdhb22 UTSW 18 37520562 missense probably damaging 1.00
R4978:Pcdhb22 UTSW 18 37518601 missense probably benign 0.16
R5047:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5061:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5063:Pcdhb22 UTSW 18 37519126 missense probably damaging 1.00
R5467:Pcdhb22 UTSW 18 37520135 missense probably benign 0.02
R6005:Pcdhb22 UTSW 18 37519736 missense possibly damaging 0.75
R6375:Pcdhb22 UTSW 18 37518304 intron probably benign
R6418:Pcdhb22 UTSW 18 37519906 missense possibly damaging 0.88
R6447:Pcdhb22 UTSW 18 37520216 missense possibly damaging 0.91
R6748:Pcdhb22 UTSW 18 37518746 missense probably damaging 0.99
R7195:Pcdhb22 UTSW 18 37519288 missense probably damaging 1.00
R7243:Pcdhb22 UTSW 18 37520632 missense probably benign 0.00
R7354:Pcdhb22 UTSW 18 37520258 missense probably damaging 1.00
R7503:Pcdhb22 UTSW 18 37519102 missense probably benign 0.39
R7765:Pcdhb22 UTSW 18 37519105 missense probably damaging 0.99
R8201:Pcdhb22 UTSW 18 37518465 intron probably benign
R8976:Pcdhb22 UTSW 18 37518343 intron probably benign
R9059:Pcdhb22 UTSW 18 37519669 missense probably damaging 1.00
R9072:Pcdhb22 UTSW 18 37518760 missense probably damaging 1.00
R9082:Pcdhb22 UTSW 18 37519994 missense probably damaging 1.00
R9299:Pcdhb22 UTSW 18 37518832 nonsense probably null
X0027:Pcdhb22 UTSW 18 37520851 missense probably benign
Z1088:Pcdhb22 UTSW 18 37519345 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CAAGCTGAGCTACGAGTAGG -3'
(R):5'- TTTGCACCCGGTAGAAAGC -3'

Sequencing Primer
(F):5'- GGAGACATTAATGATCATTCTCCTG -3'
(R):5'- CGGTAGAAAGCCTGTGCAAACTC -3'
Posted On 2016-03-01