Incidental Mutation 'R4852:Slco4c1'
ID373599
Institutional Source Beutler Lab
Gene Symbol Slco4c1
Ensembl Gene ENSMUSG00000040693
Gene Namesolute carrier organic anion transporter family, member 4C1
SynonymsOATP-H, OATP4C1, PRO2176, OATP-M1, SLC21A20, C330017E21Rik
MMRRC Submission 042464-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R4852 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location96816270-96872171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96841228 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 303 (P303L)
Ref Sequence ENSEMBL: ENSMUSP00000071875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071985]
Predicted Effect probably damaging
Transcript: ENSMUST00000071985
AA Change: P303L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071875
Gene: ENSMUSG00000040693
AA Change: P303L

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
Pfam:MFS_1 102 483 1.3e-19 PFAM
KAZAL 503 547 1.67e-1 SMART
transmembrane domain 666 688 N/A INTRINSIC
Meta Mutation Damage Score 0.1725 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLCO4C1 belongs to the organic anion transporter (OATP) family. OATPs are involved in the membrane transport of bile acids, conjugated steroids, thyroid hormone, eicosanoids, peptides, and numerous drugs in many tissues (Mikkaichi et al., 2004 [PubMed 14993604]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921524L21Rik C G 18: 6,623,487 L66V possibly damaging Het
4921524L21Rik T A 18: 6,623,488 L66Q probably damaging Het
Abca6 A G 11: 110,244,203 V252A probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acap1 C T 11: 69,884,376 V354M probably benign Het
Accs T C 2: 93,844,260 D99G probably damaging Het
Adam9 T C 8: 25,003,301 Y97C probably damaging Het
Akap6 T C 12: 53,104,675 V1174A probably damaging Het
Aknad1 C A 3: 108,751,740 D23E probably damaging Het
Ano2 T C 6: 125,982,923 C666R possibly damaging Het
Atp4a G A 7: 30,724,268 A933T probably benign Het
Atxn2 T C 5: 121,814,411 L224P probably damaging Het
Bin2 T C 15: 100,645,288 E338G probably damaging Het
Bloc1s5 T C 13: 38,634,984 K20E probably damaging Het
Bst1 A T 5: 43,820,525 D72V probably benign Het
Cacna1i T C 15: 80,388,479 F1631L probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Cfap43 A G 19: 47,897,111 I355T possibly damaging Het
Chuk A T 19: 44,088,758 M383K possibly damaging Het
Cnga4 A G 7: 105,405,730 I174V probably benign Het
Cpd T C 11: 76,785,150 K1226E probably benign Het
Crip2 T C 12: 113,140,584 C5R probably damaging Het
Cyp3a11 T A 5: 145,860,495 D358V probably damaging Het
Ebag9 T C 15: 44,624,519 F21S probably damaging Het
Ercc1 A T 7: 19,350,704 H70L probably damaging Het
Exoc3 G A 13: 74,199,645 R69C probably damaging Het
Fgfr4 A T 13: 55,161,156 R363S possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm7489 T A 15: 53,886,038 probably benign Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Gpr152 G A 19: 4,143,791 V444I probably benign Het
Gss T C 2: 155,564,865 E330G probably benign Het
Hbs1l A G 10: 21,358,388 D556G possibly damaging Het
Helz2 T C 2: 181,230,120 T2619A probably damaging Het
Hk3 A G 13: 55,012,596 F304L probably damaging Het
Itgad A T 7: 128,198,530 N906Y probably damaging Het
Jakmip2 T C 18: 43,577,400 E246G probably damaging Het
L3mbtl4 A T 17: 68,559,753 H329L probably damaging Het
Mau2 A G 8: 70,033,177 probably null Het
Myo16 T C 8: 10,373,474 L270P probably damaging Het
Naa25 T C 5: 121,430,692 S606P probably damaging Het
Nags T A 11: 102,146,621 C179* probably null Het
Naip2 A G 13: 100,161,536 M664T probably benign Het
Ndufv3 T C 17: 31,528,069 I311T probably benign Het
Nipsnap1 G T 11: 4,891,468 E258* probably null Het
Nudc A G 4: 133,534,349 L208P probably damaging Het
Olfr33 A T 7: 102,713,543 V290E probably damaging Het
Olfr392 T C 11: 73,814,248 Y278C probably benign Het
Oscp1 A G 4: 126,076,859 D137G possibly damaging Het
Pcdhb5 C T 18: 37,322,471 P635S probably benign Het
Pcdhgb2 T A 18: 37,692,050 I698N probably damaging Het
Pde4b A G 4: 102,597,770 Y399C probably damaging Het
Pdf A T 8: 107,048,180 V140E probably damaging Het
Pglyrp2 T C 17: 32,415,849 N513S probably benign Het
Ranbp2 T A 10: 58,477,056 D1199E possibly damaging Het
Rell2 G T 18: 37,956,568 probably null Het
Rgl2 A G 17: 33,937,173 H745R probably benign Het
Rnf121 A G 7: 102,023,385 C264R probably damaging Het
Rnf181 A G 6: 72,361,516 F3S probably damaging Het
Rsrc1 T A 3: 67,355,602 D296E probably damaging Het
Rubcn A T 16: 32,843,308 D319E probably damaging Het
Scaf8 T C 17: 3,178,219 S431P unknown Het
Sept11 T A 5: 93,162,253 M305K possibly damaging Het
Serpinb12 A G 1: 106,956,402 K293E probably benign Het
Sh3bp1 T A 15: 78,904,338 H229Q probably benign Het
Specc1 T A 11: 62,211,684 V952E probably damaging Het
Spint2 G A 7: 29,256,786 T158I probably benign Het
St8sia4 A T 1: 95,660,898 W71R probably damaging Het
Tex48 C T 4: 63,611,914 V23I possibly damaging Het
Tmc5 G A 7: 118,645,339 G480D probably benign Het
Tmem8b T A 4: 43,689,713 M330K probably damaging Het
Tnrc18 C T 5: 142,731,340 R2453Q probably damaging Het
Trank1 A T 9: 111,391,895 N2567Y possibly damaging Het
Trps1 T C 15: 50,846,309 D211G probably damaging Het
Ttn T C 2: 76,725,159 R30501G probably damaging Het
Ttn T A 2: 76,742,903 Y25882F probably damaging Het
Unc79 T A 12: 103,173,466 V2495E probably damaging Het
Uqcr10 T A 11: 4,702,198 H58L possibly damaging Het
Usp7 A T 16: 8,756,844 C58* probably null Het
Vmn1r36 A T 6: 66,716,888 M1K probably null Het
Wdr7 T A 18: 63,777,949 M804K probably damaging Het
Zfp131 A C 13: 119,788,858 probably null Het
Zfp507 A G 7: 35,794,055 V521A probably benign Het
Other mutations in Slco4c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Slco4c1 APN 1 96841187 missense probably damaging 0.99
IGL01510:Slco4c1 APN 1 96867953 missense probably damaging 1.00
IGL01674:Slco4c1 APN 1 96842493 missense probably damaging 1.00
IGL02444:Slco4c1 APN 1 96844509 missense probably damaging 1.00
IGL03355:Slco4c1 APN 1 96842507 nonsense probably null
H8562:Slco4c1 UTSW 1 96842485 missense probably benign 0.01
H8786:Slco4c1 UTSW 1 96841151 missense probably damaging 1.00
R0350:Slco4c1 UTSW 1 96828849 missense probably benign 0.18
R0463:Slco4c1 UTSW 1 96867920 missense possibly damaging 0.93
R0550:Slco4c1 UTSW 1 96867859 missense probably damaging 1.00
R1122:Slco4c1 UTSW 1 96828836 missense possibly damaging 0.89
R1205:Slco4c1 UTSW 1 96867888 missense probably damaging 1.00
R1215:Slco4c1 UTSW 1 96828871 missense probably damaging 1.00
R1466:Slco4c1 UTSW 1 96841172 missense probably damaging 0.97
R1466:Slco4c1 UTSW 1 96841172 missense probably damaging 0.97
R1907:Slco4c1 UTSW 1 96842499 missense probably damaging 1.00
R1960:Slco4c1 UTSW 1 96867929 missense probably benign 0.00
R2372:Slco4c1 UTSW 1 96821200 missense probably benign 0.00
R3424:Slco4c1 UTSW 1 96841251 missense probably benign 0.02
R3425:Slco4c1 UTSW 1 96841251 missense probably benign 0.02
R4292:Slco4c1 UTSW 1 96844656 critical splice acceptor site probably null
R4656:Slco4c1 UTSW 1 96841245 missense probably benign 0.01
R4854:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4865:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4867:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R4898:Slco4c1 UTSW 1 96837512 missense probably damaging 1.00
R4900:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5023:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5074:Slco4c1 UTSW 1 96841228 missense probably damaging 1.00
R5348:Slco4c1 UTSW 1 96842529 missense probably damaging 0.99
R5356:Slco4c1 UTSW 1 96832110 missense probably damaging 1.00
R5471:Slco4c1 UTSW 1 96872045 missense probably benign 0.34
R5683:Slco4c1 UTSW 1 96867834 missense probably damaging 1.00
R5797:Slco4c1 UTSW 1 96819104 missense probably benign 0.04
R5801:Slco4c1 UTSW 1 96872084 missense probably damaging 0.96
R5837:Slco4c1 UTSW 1 96818982 missense probably benign 0.40
R6242:Slco4c1 UTSW 1 96839283 missense probably damaging 0.99
R7014:Slco4c1 UTSW 1 96823781 intron probably null
R7112:Slco4c1 UTSW 1 96841141 missense probably damaging 1.00
R7174:Slco4c1 UTSW 1 96837598 missense possibly damaging 0.87
R7265:Slco4c1 UTSW 1 96871793 missense probably damaging 0.99
R7275:Slco4c1 UTSW 1 96871772 missense probably benign 0.38
R7305:Slco4c1 UTSW 1 96828965 missense probably damaging 1.00
R7428:Slco4c1 UTSW 1 96837520 missense possibly damaging 0.68
R7649:Slco4c1 UTSW 1 96828942 missense probably benign 0.03
Z1176:Slco4c1 UTSW 1 96821230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGACAGGAATTGGGTGATTCTAGAG -3'
(R):5'- TATGATGCTTTCTGGACCATTACTC -3'

Sequencing Primer
(F):5'- CCTGGTAAATGCTTGGGAA -3'
(R):5'- TGTATGTCTCTGCATGCTATTTGAC -3'
Posted On2016-03-01