Incidental Mutation 'R4852:Hbs1l'
ID373637
Institutional Source Beutler Lab
Gene Symbol Hbs1l
Ensembl Gene ENSMUSG00000019977
Gene NameHbs1-like (S. cerevisiae)
Synonyms2810035F15Rik, eRFS
MMRRC Submission 042464-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4852 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location21295979-21368898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21358388 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 556 (D556G)
Ref Sequence ENSEMBL: ENSMUSP00000151689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020153] [ENSMUST00000219915]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020153
AA Change: D553G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020153
Gene: ENSMUSG00000019977
AA Change: D553G

DomainStartEndE-ValueType
Pfam:HBS1_N 33 125 1e-22 PFAM
low complexity region 142 155 N/A INTRINSIC
Pfam:GTP_EFTU 256 521 1.7e-48 PFAM
Pfam:GTP_EFTU_D3 572 681 9.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218850
Predicted Effect possibly damaging
Transcript: ENSMUST00000219915
AA Change: D556G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding elongation factor family. It is expressed in multiple tissues with the highest expression in heart and skeletal muscle. The intergenic region of this gene and the MYB gene has been identified to be a quantitative trait locus (QTL) controlling fetal hemoglobin level, and this region influnces erythrocyte, platelet, and monocyte counts as well as erythrocyte volume and hemoglobin content. DNA polymorphisms at this region associate with fetal hemoglobin levels and pain crises in sickle cell disease. A single nucleotide polymorphism in exon 1 of this gene is significantly associated with severity in beta-thalassemia/Hemoglobin E. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921524L21Rik C G 18: 6,623,487 L66V possibly damaging Het
4921524L21Rik T A 18: 6,623,488 L66Q probably damaging Het
Abca6 A G 11: 110,244,203 V252A probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acap1 C T 11: 69,884,376 V354M probably benign Het
Accs T C 2: 93,844,260 D99G probably damaging Het
Adam9 T C 8: 25,003,301 Y97C probably damaging Het
Akap6 T C 12: 53,104,675 V1174A probably damaging Het
Aknad1 C A 3: 108,751,740 D23E probably damaging Het
Ano2 T C 6: 125,982,923 C666R possibly damaging Het
Atp4a G A 7: 30,724,268 A933T probably benign Het
Atxn2 T C 5: 121,814,411 L224P probably damaging Het
Bin2 T C 15: 100,645,288 E338G probably damaging Het
Bloc1s5 T C 13: 38,634,984 K20E probably damaging Het
Bst1 A T 5: 43,820,525 D72V probably benign Het
Cacna1i T C 15: 80,388,479 F1631L probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Cfap43 A G 19: 47,897,111 I355T possibly damaging Het
Chuk A T 19: 44,088,758 M383K possibly damaging Het
Cnga4 A G 7: 105,405,730 I174V probably benign Het
Cpd T C 11: 76,785,150 K1226E probably benign Het
Crip2 T C 12: 113,140,584 C5R probably damaging Het
Cyp3a11 T A 5: 145,860,495 D358V probably damaging Het
Ebag9 T C 15: 44,624,519 F21S probably damaging Het
Ercc1 A T 7: 19,350,704 H70L probably damaging Het
Exoc3 G A 13: 74,199,645 R69C probably damaging Het
Fgfr4 A T 13: 55,161,156 R363S possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm7489 T A 15: 53,886,038 probably benign Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Gpr152 G A 19: 4,143,791 V444I probably benign Het
Gss T C 2: 155,564,865 E330G probably benign Het
Helz2 T C 2: 181,230,120 T2619A probably damaging Het
Hk3 A G 13: 55,012,596 F304L probably damaging Het
Itgad A T 7: 128,198,530 N906Y probably damaging Het
Jakmip2 T C 18: 43,577,400 E246G probably damaging Het
L3mbtl4 A T 17: 68,559,753 H329L probably damaging Het
Mau2 A G 8: 70,033,177 probably null Het
Myo16 T C 8: 10,373,474 L270P probably damaging Het
Naa25 T C 5: 121,430,692 S606P probably damaging Het
Nags T A 11: 102,146,621 C179* probably null Het
Naip2 A G 13: 100,161,536 M664T probably benign Het
Ndufv3 T C 17: 31,528,069 I311T probably benign Het
Nipsnap1 G T 11: 4,891,468 E258* probably null Het
Nudc A G 4: 133,534,349 L208P probably damaging Het
Olfr33 A T 7: 102,713,543 V290E probably damaging Het
Olfr392 T C 11: 73,814,248 Y278C probably benign Het
Oscp1 A G 4: 126,076,859 D137G possibly damaging Het
Pcdhb5 C T 18: 37,322,471 P635S probably benign Het
Pcdhgb2 T A 18: 37,692,050 I698N probably damaging Het
Pde4b A G 4: 102,597,770 Y399C probably damaging Het
Pdf A T 8: 107,048,180 V140E probably damaging Het
Pglyrp2 T C 17: 32,415,849 N513S probably benign Het
Ranbp2 T A 10: 58,477,056 D1199E possibly damaging Het
Rell2 G T 18: 37,956,568 probably null Het
Rgl2 A G 17: 33,937,173 H745R probably benign Het
Rnf121 A G 7: 102,023,385 C264R probably damaging Het
Rnf181 A G 6: 72,361,516 F3S probably damaging Het
Rsrc1 T A 3: 67,355,602 D296E probably damaging Het
Rubcn A T 16: 32,843,308 D319E probably damaging Het
Scaf8 T C 17: 3,178,219 S431P unknown Het
Sept11 T A 5: 93,162,253 M305K possibly damaging Het
Serpinb12 A G 1: 106,956,402 K293E probably benign Het
Sh3bp1 T A 15: 78,904,338 H229Q probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Specc1 T A 11: 62,211,684 V952E probably damaging Het
Spint2 G A 7: 29,256,786 T158I probably benign Het
St8sia4 A T 1: 95,660,898 W71R probably damaging Het
Tex48 C T 4: 63,611,914 V23I possibly damaging Het
Tmc5 G A 7: 118,645,339 G480D probably benign Het
Tmem8b T A 4: 43,689,713 M330K probably damaging Het
Tnrc18 C T 5: 142,731,340 R2453Q probably damaging Het
Trank1 A T 9: 111,391,895 N2567Y possibly damaging Het
Trps1 T C 15: 50,846,309 D211G probably damaging Het
Ttn T C 2: 76,725,159 R30501G probably damaging Het
Ttn T A 2: 76,742,903 Y25882F probably damaging Het
Unc79 T A 12: 103,173,466 V2495E probably damaging Het
Uqcr10 T A 11: 4,702,198 H58L possibly damaging Het
Usp7 A T 16: 8,756,844 C58* probably null Het
Vmn1r36 A T 6: 66,716,888 M1K probably null Het
Wdr7 T A 18: 63,777,949 M804K probably damaging Het
Zfp131 A C 13: 119,788,858 probably null Het
Zfp507 A G 7: 35,794,055 V521A probably benign Het
Other mutations in Hbs1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Hbs1l APN 10 21307756 missense probably benign 0.03
IGL02948:Hbs1l APN 10 21341711 splice site probably benign
R0375:Hbs1l UTSW 10 21342541 missense possibly damaging 0.76
R0465:Hbs1l UTSW 10 21352041 missense probably null 0.85
R0555:Hbs1l UTSW 10 21349323 missense probably benign 0.14
R0909:Hbs1l UTSW 10 21307738 missense probably benign 0.00
R1172:Hbs1l UTSW 10 21304638 missense probably damaging 1.00
R1594:Hbs1l UTSW 10 21352023 missense probably benign 0.00
R1612:Hbs1l UTSW 10 21358835 missense probably damaging 1.00
R1869:Hbs1l UTSW 10 21358406 splice site probably null
R2109:Hbs1l UTSW 10 21341932 nonsense probably null
R2369:Hbs1l UTSW 10 21307745 missense probably benign 0.01
R2404:Hbs1l UTSW 10 21296047 start gained probably benign
R4077:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4079:Hbs1l UTSW 10 21352602 missense probably damaging 1.00
R4534:Hbs1l UTSW 10 21341915 missense possibly damaging 0.74
R4796:Hbs1l UTSW 10 21342506 missense probably damaging 1.00
R5069:Hbs1l UTSW 10 21354647 missense probably damaging 1.00
R5946:Hbs1l UTSW 10 21341756 missense probably benign
R6232:Hbs1l UTSW 10 21307758 splice site probably null
R6264:Hbs1l UTSW 10 21367757 missense possibly damaging 0.92
R6542:Hbs1l UTSW 10 21304617 missense probably benign 0.11
R6831:Hbs1l UTSW 10 21341868 missense probably benign 0.29
R7295:Hbs1l UTSW 10 21310152 missense probably benign 0.12
R7470:Hbs1l UTSW 10 21358784 missense possibly damaging 0.96
R7652:Hbs1l UTSW 10 21364760 missense probably benign 0.02
R7695:Hbs1l UTSW 10 21299217 missense possibly damaging 0.49
R7909:Hbs1l UTSW 10 21358404 critical splice donor site probably null
R8325:Hbs1l UTSW 10 21307649 missense probably benign 0.02
R8353:Hbs1l UTSW 10 21309279 missense probably benign
R8453:Hbs1l UTSW 10 21309279 missense probably benign
R8878:Hbs1l UTSW 10 21358812 missense possibly damaging 0.47
R8880:Hbs1l UTSW 10 21309969 missense probably damaging 0.99
X0018:Hbs1l UTSW 10 21351987 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGTCTGGAGAAACGCTGC -3'
(R):5'- TGTGCCAACATGAATTAACTCCAC -3'

Sequencing Primer
(F):5'- GAGAAACGCTGCTTCCTCCATG -3'
(R):5'- GCCAACATGAATTAACTCCACTTTAG -3'
Posted On2016-03-01