Incidental Mutation 'R4852:Gas2l3'
ID373639
Institutional Source Beutler Lab
Gene Symbol Gas2l3
Ensembl Gene ENSMUSG00000074802
Gene Namegrowth arrest-specific 2 like 3
Synonyms8430435B07Rik, LOC237436
MMRRC Submission 042464-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R4852 (G1)
Quality Score217
Status Not validated
Chromosome10
Chromosomal Location89408823-89443967 bp(-) (GRCm38)
Type of Mutationsmall deletion (3 aa in frame mutation)
DNA Base Change (assembly) CACTCGTCATACT to CACT at 89430958 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099374] [ENSMUST00000105298] [ENSMUST00000218764] [ENSMUST00000219351] [ENSMUST00000220071] [ENSMUST00000220128] [ENSMUST00000220234]
Predicted Effect probably benign
Transcript: ENSMUST00000099374
SMART Domains Protein: ENSMUSP00000096973
Gene: ENSMUSG00000074802

DomainStartEndE-ValueType
CH 52 166 1.71e-9 SMART
low complexity region 179 194 N/A INTRINSIC
Pfam:GAS2 215 284 1.8e-29 PFAM
low complexity region 446 460 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105298
SMART Domains Protein: ENSMUSP00000100935
Gene: ENSMUSG00000074802

DomainStartEndE-ValueType
CH 52 166 1.71e-9 SMART
low complexity region 179 194 N/A INTRINSIC
Pfam:GAS2 213 286 1.5e-31 PFAM
low complexity region 446 460 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219073
Predicted Effect probably benign
Transcript: ENSMUST00000219351
Predicted Effect probably benign
Transcript: ENSMUST00000220071
Predicted Effect probably benign
Transcript: ENSMUST00000220128
Predicted Effect probably benign
Transcript: ENSMUST00000220234
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial postnatal lethality with none surviving past 4 months, dilated cardiomyopathy, cardiac interstitial fibrosis, and premature binucleation of cardiomyocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921524L21Rik C G 18: 6,623,487 L66V possibly damaging Het
4921524L21Rik T A 18: 6,623,488 L66Q probably damaging Het
Abca6 A G 11: 110,244,203 V252A probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acap1 C T 11: 69,884,376 V354M probably benign Het
Accs T C 2: 93,844,260 D99G probably damaging Het
Adam9 T C 8: 25,003,301 Y97C probably damaging Het
Akap6 T C 12: 53,104,675 V1174A probably damaging Het
Aknad1 C A 3: 108,751,740 D23E probably damaging Het
Ano2 T C 6: 125,982,923 C666R possibly damaging Het
Atp4a G A 7: 30,724,268 A933T probably benign Het
Atxn2 T C 5: 121,814,411 L224P probably damaging Het
Bin2 T C 15: 100,645,288 E338G probably damaging Het
Bloc1s5 T C 13: 38,634,984 K20E probably damaging Het
Bst1 A T 5: 43,820,525 D72V probably benign Het
Cacna1i T C 15: 80,388,479 F1631L probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Cfap43 A G 19: 47,897,111 I355T possibly damaging Het
Chuk A T 19: 44,088,758 M383K possibly damaging Het
Cnga4 A G 7: 105,405,730 I174V probably benign Het
Cpd T C 11: 76,785,150 K1226E probably benign Het
Crip2 T C 12: 113,140,584 C5R probably damaging Het
Cyp3a11 T A 5: 145,860,495 D358V probably damaging Het
Ebag9 T C 15: 44,624,519 F21S probably damaging Het
Ercc1 A T 7: 19,350,704 H70L probably damaging Het
Exoc3 G A 13: 74,199,645 R69C probably damaging Het
Fgfr4 A T 13: 55,161,156 R363S possibly damaging Het
Gm7489 T A 15: 53,886,038 probably benign Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Gpr152 G A 19: 4,143,791 V444I probably benign Het
Gss T C 2: 155,564,865 E330G probably benign Het
Hbs1l A G 10: 21,358,388 D556G possibly damaging Het
Helz2 T C 2: 181,230,120 T2619A probably damaging Het
Hk3 A G 13: 55,012,596 F304L probably damaging Het
Itgad A T 7: 128,198,530 N906Y probably damaging Het
Jakmip2 T C 18: 43,577,400 E246G probably damaging Het
L3mbtl4 A T 17: 68,559,753 H329L probably damaging Het
Mau2 A G 8: 70,033,177 probably null Het
Myo16 T C 8: 10,373,474 L270P probably damaging Het
Naa25 T C 5: 121,430,692 S606P probably damaging Het
Nags T A 11: 102,146,621 C179* probably null Het
Naip2 A G 13: 100,161,536 M664T probably benign Het
Ndufv3 T C 17: 31,528,069 I311T probably benign Het
Nipsnap1 G T 11: 4,891,468 E258* probably null Het
Nudc A G 4: 133,534,349 L208P probably damaging Het
Olfr33 A T 7: 102,713,543 V290E probably damaging Het
Olfr392 T C 11: 73,814,248 Y278C probably benign Het
Oscp1 A G 4: 126,076,859 D137G possibly damaging Het
Pcdhb5 C T 18: 37,322,471 P635S probably benign Het
Pcdhgb2 T A 18: 37,692,050 I698N probably damaging Het
Pde4b A G 4: 102,597,770 Y399C probably damaging Het
Pdf A T 8: 107,048,180 V140E probably damaging Het
Pglyrp2 T C 17: 32,415,849 N513S probably benign Het
Ranbp2 T A 10: 58,477,056 D1199E possibly damaging Het
Rell2 G T 18: 37,956,568 probably null Het
Rgl2 A G 17: 33,937,173 H745R probably benign Het
Rnf121 A G 7: 102,023,385 C264R probably damaging Het
Rnf181 A G 6: 72,361,516 F3S probably damaging Het
Rsrc1 T A 3: 67,355,602 D296E probably damaging Het
Rubcn A T 16: 32,843,308 D319E probably damaging Het
Scaf8 T C 17: 3,178,219 S431P unknown Het
Sept11 T A 5: 93,162,253 M305K possibly damaging Het
Serpinb12 A G 1: 106,956,402 K293E probably benign Het
Sh3bp1 T A 15: 78,904,338 H229Q probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Specc1 T A 11: 62,211,684 V952E probably damaging Het
Spint2 G A 7: 29,256,786 T158I probably benign Het
St8sia4 A T 1: 95,660,898 W71R probably damaging Het
Tex48 C T 4: 63,611,914 V23I possibly damaging Het
Tmc5 G A 7: 118,645,339 G480D probably benign Het
Tmem8b T A 4: 43,689,713 M330K probably damaging Het
Tnrc18 C T 5: 142,731,340 R2453Q probably damaging Het
Trank1 A T 9: 111,391,895 N2567Y possibly damaging Het
Trps1 T C 15: 50,846,309 D211G probably damaging Het
Ttn T C 2: 76,725,159 R30501G probably damaging Het
Ttn T A 2: 76,742,903 Y25882F probably damaging Het
Unc79 T A 12: 103,173,466 V2495E probably damaging Het
Uqcr10 T A 11: 4,702,198 H58L possibly damaging Het
Usp7 A T 16: 8,756,844 C58* probably null Het
Vmn1r36 A T 6: 66,716,888 M1K probably null Het
Wdr7 T A 18: 63,777,949 M804K probably damaging Het
Zfp131 A C 13: 119,788,858 probably null Het
Zfp507 A G 7: 35,794,055 V521A probably benign Het
Other mutations in Gas2l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Gas2l3 APN 10 89413627 missense probably benign 0.00
IGL01148:Gas2l3 APN 10 89413504 missense probably benign 0.25
R0472:Gas2l3 UTSW 10 89426477 missense probably damaging 1.00
R0578:Gas2l3 UTSW 10 89417075 missense probably damaging 1.00
R0720:Gas2l3 UTSW 10 89413943 missense probably benign 0.00
R1386:Gas2l3 UTSW 10 89414353 missense possibly damaging 0.77
R1470:Gas2l3 UTSW 10 89413934 missense probably benign
R1470:Gas2l3 UTSW 10 89413934 missense probably benign
R1530:Gas2l3 UTSW 10 89433769 missense probably benign 0.02
R1733:Gas2l3 UTSW 10 89414265 missense probably damaging 1.00
R1772:Gas2l3 UTSW 10 89417014 unclassified probably benign
R1840:Gas2l3 UTSW 10 89422251 missense possibly damaging 0.79
R2168:Gas2l3 UTSW 10 89414098 missense probably benign 0.01
R3082:Gas2l3 UTSW 10 89430958 small deletion probably benign
R3083:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4639:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4641:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4642:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4643:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4644:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4645:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4809:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4810:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4820:Gas2l3 UTSW 10 89417045 missense probably damaging 1.00
R4853:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4855:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4865:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4900:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4906:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4926:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4946:Gas2l3 UTSW 10 89413772 missense probably benign
R5072:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5073:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5074:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5137:Gas2l3 UTSW 10 89413975 missense probably damaging 1.00
R5579:Gas2l3 UTSW 10 89414066 missense probably benign
R5919:Gas2l3 UTSW 10 89417055 missense probably damaging 1.00
R6573:Gas2l3 UTSW 10 89422210 splice site probably null
R6763:Gas2l3 UTSW 10 89413369 missense probably benign 0.00
R6961:Gas2l3 UTSW 10 89413291 missense probably benign 0.00
R7491:Gas2l3 UTSW 10 89413901 missense probably benign 0.02
R7707:Gas2l3 UTSW 10 89414358 missense probably damaging 1.00
R7806:Gas2l3 UTSW 10 89413370 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTGACTCTGACATTCACTG -3'
(R):5'- GACATCAACCACTGTATTCAATGC -3'

Sequencing Primer
(F):5'- ACTGAGTATCCCTGGCATCTGG -3'
(R):5'- ACAATTTTGCTTATTCTGGATGGTC -3'
Posted On2016-03-01