Incidental Mutation 'R4852:Trps1'
ID373665
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Nametranscriptional repressor GATA binding 1
SynonymsD15Ertd586e
MMRRC Submission 042464-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4852 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location50654752-50890463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50846309 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 211 (D211G)
Ref Sequence ENSEMBL: ENSMUSP00000138967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885] [ENSMUST00000185183]
Predicted Effect probably damaging
Transcript: ENSMUST00000077935
AA Change: D211G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: D211G

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165201
AA Change: D211G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: D211G

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183757
AA Change: D215G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: D215G

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183997
AA Change: D215G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: D215G

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184458
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184885
AA Change: D165G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: D165G

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185183
AA Change: D211G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138967
Gene: ENSMUSG00000038679
AA Change: D211G

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921524L21Rik C G 18: 6,623,487 L66V possibly damaging Het
4921524L21Rik T A 18: 6,623,488 L66Q probably damaging Het
Abca6 A G 11: 110,244,203 V252A probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acap1 C T 11: 69,884,376 V354M probably benign Het
Accs T C 2: 93,844,260 D99G probably damaging Het
Adam9 T C 8: 25,003,301 Y97C probably damaging Het
Akap6 T C 12: 53,104,675 V1174A probably damaging Het
Aknad1 C A 3: 108,751,740 D23E probably damaging Het
Ano2 T C 6: 125,982,923 C666R possibly damaging Het
Atp4a G A 7: 30,724,268 A933T probably benign Het
Atxn2 T C 5: 121,814,411 L224P probably damaging Het
Bin2 T C 15: 100,645,288 E338G probably damaging Het
Bloc1s5 T C 13: 38,634,984 K20E probably damaging Het
Bst1 A T 5: 43,820,525 D72V probably benign Het
Cacna1i T C 15: 80,388,479 F1631L probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Cfap43 A G 19: 47,897,111 I355T possibly damaging Het
Chuk A T 19: 44,088,758 M383K possibly damaging Het
Cnga4 A G 7: 105,405,730 I174V probably benign Het
Cpd T C 11: 76,785,150 K1226E probably benign Het
Crip2 T C 12: 113,140,584 C5R probably damaging Het
Cyp3a11 T A 5: 145,860,495 D358V probably damaging Het
Ebag9 T C 15: 44,624,519 F21S probably damaging Het
Ercc1 A T 7: 19,350,704 H70L probably damaging Het
Exoc3 G A 13: 74,199,645 R69C probably damaging Het
Fgfr4 A T 13: 55,161,156 R363S possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm7489 T A 15: 53,886,038 probably benign Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Gpr152 G A 19: 4,143,791 V444I probably benign Het
Gss T C 2: 155,564,865 E330G probably benign Het
Hbs1l A G 10: 21,358,388 D556G possibly damaging Het
Helz2 T C 2: 181,230,120 T2619A probably damaging Het
Hk3 A G 13: 55,012,596 F304L probably damaging Het
Itgad A T 7: 128,198,530 N906Y probably damaging Het
Jakmip2 T C 18: 43,577,400 E246G probably damaging Het
L3mbtl4 A T 17: 68,559,753 H329L probably damaging Het
Mau2 A G 8: 70,033,177 probably null Het
Myo16 T C 8: 10,373,474 L270P probably damaging Het
Naa25 T C 5: 121,430,692 S606P probably damaging Het
Nags T A 11: 102,146,621 C179* probably null Het
Naip2 A G 13: 100,161,536 M664T probably benign Het
Ndufv3 T C 17: 31,528,069 I311T probably benign Het
Nipsnap1 G T 11: 4,891,468 E258* probably null Het
Nudc A G 4: 133,534,349 L208P probably damaging Het
Olfr33 A T 7: 102,713,543 V290E probably damaging Het
Olfr392 T C 11: 73,814,248 Y278C probably benign Het
Oscp1 A G 4: 126,076,859 D137G possibly damaging Het
Pcdhb5 C T 18: 37,322,471 P635S probably benign Het
Pcdhgb2 T A 18: 37,692,050 I698N probably damaging Het
Pde4b A G 4: 102,597,770 Y399C probably damaging Het
Pdf A T 8: 107,048,180 V140E probably damaging Het
Pglyrp2 T C 17: 32,415,849 N513S probably benign Het
Ranbp2 T A 10: 58,477,056 D1199E possibly damaging Het
Rell2 G T 18: 37,956,568 probably null Het
Rgl2 A G 17: 33,937,173 H745R probably benign Het
Rnf121 A G 7: 102,023,385 C264R probably damaging Het
Rnf181 A G 6: 72,361,516 F3S probably damaging Het
Rsrc1 T A 3: 67,355,602 D296E probably damaging Het
Rubcn A T 16: 32,843,308 D319E probably damaging Het
Scaf8 T C 17: 3,178,219 S431P unknown Het
Sept11 T A 5: 93,162,253 M305K possibly damaging Het
Serpinb12 A G 1: 106,956,402 K293E probably benign Het
Sh3bp1 T A 15: 78,904,338 H229Q probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Specc1 T A 11: 62,211,684 V952E probably damaging Het
Spint2 G A 7: 29,256,786 T158I probably benign Het
St8sia4 A T 1: 95,660,898 W71R probably damaging Het
Tex48 C T 4: 63,611,914 V23I possibly damaging Het
Tmc5 G A 7: 118,645,339 G480D probably benign Het
Tmem8b T A 4: 43,689,713 M330K probably damaging Het
Tnrc18 C T 5: 142,731,340 R2453Q probably damaging Het
Trank1 A T 9: 111,391,895 N2567Y possibly damaging Het
Ttn T C 2: 76,725,159 R30501G probably damaging Het
Ttn T A 2: 76,742,903 Y25882F probably damaging Het
Unc79 T A 12: 103,173,466 V2495E probably damaging Het
Uqcr10 T A 11: 4,702,198 H58L possibly damaging Het
Usp7 A T 16: 8,756,844 C58* probably null Het
Vmn1r36 A T 6: 66,716,888 M1K probably null Het
Wdr7 T A 18: 63,777,949 M804K probably damaging Het
Zfp131 A C 13: 119,788,858 probably null Het
Zfp507 A G 7: 35,794,055 V521A probably benign Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50846870 missense probably benign 0.07
IGL00497:Trps1 APN 15 50661307 missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50661085 missense probably damaging 1.00
IGL01325:Trps1 APN 15 50846814 missense probably benign 0.40
IGL02132:Trps1 APN 15 50822278 missense probably damaging 1.00
IGL02631:Trps1 APN 15 50846021 missense probably damaging 1.00
IGL02740:Trps1 APN 15 50846539 missense probably damaging 1.00
IGL02821:Trps1 APN 15 50660877 missense probably damaging 1.00
IGL03096:Trps1 APN 15 50846479 missense probably benign
F5770:Trps1 UTSW 15 50831577 missense probably damaging 1.00
R0050:Trps1 UTSW 15 50765525 missense probably benign 0.18
R0244:Trps1 UTSW 15 50664743 missense probably damaging 1.00
R0377:Trps1 UTSW 15 50831778 nonsense probably null
R0599:Trps1 UTSW 15 50831860 nonsense probably null
R0848:Trps1 UTSW 15 50661549 missense possibly damaging 0.54
R1744:Trps1 UTSW 15 50661213 missense probably damaging 1.00
R1830:Trps1 UTSW 15 50661136 missense probably damaging 0.99
R2083:Trps1 UTSW 15 50822305 missense probably damaging 1.00
R2167:Trps1 UTSW 15 50831730 missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50822398 missense probably damaging 1.00
R2314:Trps1 UTSW 15 50661346 missense probably damaging 1.00
R3735:Trps1 UTSW 15 50846060 missense possibly damaging 0.94
R4133:Trps1 UTSW 15 50831387 missense probably damaging 1.00
R4223:Trps1 UTSW 15 50846648 missense probably benign
R4280:Trps1 UTSW 15 50846082 missense probably benign 0.00
R4566:Trps1 UTSW 15 50831678 missense probably damaging 1.00
R4810:Trps1 UTSW 15 50822296 missense probably benign 0.14
R4828:Trps1 UTSW 15 50660677 makesense probably null
R4838:Trps1 UTSW 15 50827316 missense probably benign 0.05
R5001:Trps1 UTSW 15 50661307 missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50664760 missense probably damaging 1.00
R5463:Trps1 UTSW 15 50831890 nonsense probably null
R5677:Trps1 UTSW 15 50846108 missense probably damaging 1.00
R5691:Trps1 UTSW 15 50827304 missense probably benign
R6432:Trps1 UTSW 15 50831397 missense probably damaging 0.96
R6528:Trps1 UTSW 15 50822427 missense probably benign 0.01
R6594:Trps1 UTSW 15 50830955 missense probably damaging 0.99
R6827:Trps1 UTSW 15 50822563 missense probably benign 0.14
R6862:Trps1 UTSW 15 50831605 critical splice donor site probably null
R6912:Trps1 UTSW 15 50822298 missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50822397 missense possibly damaging 0.95
R7846:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7857:Trps1 UTSW 15 50661005 missense probably damaging 1.00
V7580:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7581:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7583:Trps1 UTSW 15 50831577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGGCTGAACTGCACCATG -3'
(R):5'- CATCAGGGGATTCATTGGAGAC -3'

Sequencing Primer
(F):5'- CTGCACCATGTTATGAAGGGC -3'
(R):5'- CAAAGGAAGAGCATAAAATGTCACC -3'
Posted On2016-03-01