Incidental Mutation 'R4852:Pglyrp2'
ID373673
Institutional Source Beutler Lab
Gene Symbol Pglyrp2
Ensembl Gene ENSMUSG00000079563
Gene Namepeptidoglycan recognition protein 2
SynonymstagL-alpha, PGRP-L, tagl-beta, tagL, C730002N09Rik, Pglyrpl
MMRRC Submission 042464-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4852 (G1)
Quality Score98
Status Not validated
Chromosome17
Chromosomal Location32413100-32424167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32415849 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 513 (N513S)
Ref Sequence ENSEMBL: ENSMUSP00000129964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114455] [ENSMUST00000170392]
Predicted Effect probably benign
Transcript: ENSMUST00000114455
AA Change: N513S

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110099
Gene: ENSMUSG00000079563
AA Change: N513S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
PGRP 360 506 6.61e-78 SMART
Ami_2 373 512 6.28e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170392
AA Change: N513S

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000129964
Gene: ENSMUSG00000079563
AA Change: N513S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
low complexity region 270 281 N/A INTRINSIC
PGRP 360 506 6.61e-78 SMART
Ami_2 373 512 6.28e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peptidoglycan recognition protein, which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. This protein hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in bacterial cell wall glycopeptides, and thus may play a scavenger role by digesting biologically active peptidoglycan into biologically inactive fragments. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruption of this gene are viable and fertile with no gross developmental defects. Mice homozygous for a different knock-out allele are resistant to peptidoglycan- or muramyl dipeptide-induced arthritis and increased susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921524L21Rik C G 18: 6,623,487 L66V possibly damaging Het
4921524L21Rik T A 18: 6,623,488 L66Q probably damaging Het
Abca6 A G 11: 110,244,203 V252A probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acap1 C T 11: 69,884,376 V354M probably benign Het
Accs T C 2: 93,844,260 D99G probably damaging Het
Adam9 T C 8: 25,003,301 Y97C probably damaging Het
Akap6 T C 12: 53,104,675 V1174A probably damaging Het
Aknad1 C A 3: 108,751,740 D23E probably damaging Het
Ano2 T C 6: 125,982,923 C666R possibly damaging Het
Atp4a G A 7: 30,724,268 A933T probably benign Het
Atxn2 T C 5: 121,814,411 L224P probably damaging Het
Bin2 T C 15: 100,645,288 E338G probably damaging Het
Bloc1s5 T C 13: 38,634,984 K20E probably damaging Het
Bst1 A T 5: 43,820,525 D72V probably benign Het
Cacna1i T C 15: 80,388,479 F1631L probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Cfap43 A G 19: 47,897,111 I355T possibly damaging Het
Chuk A T 19: 44,088,758 M383K possibly damaging Het
Cnga4 A G 7: 105,405,730 I174V probably benign Het
Cpd T C 11: 76,785,150 K1226E probably benign Het
Crip2 T C 12: 113,140,584 C5R probably damaging Het
Cyp3a11 T A 5: 145,860,495 D358V probably damaging Het
Ebag9 T C 15: 44,624,519 F21S probably damaging Het
Ercc1 A T 7: 19,350,704 H70L probably damaging Het
Exoc3 G A 13: 74,199,645 R69C probably damaging Het
Fgfr4 A T 13: 55,161,156 R363S possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm7489 T A 15: 53,886,038 probably benign Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Gpr152 G A 19: 4,143,791 V444I probably benign Het
Gss T C 2: 155,564,865 E330G probably benign Het
Hbs1l A G 10: 21,358,388 D556G possibly damaging Het
Helz2 T C 2: 181,230,120 T2619A probably damaging Het
Hk3 A G 13: 55,012,596 F304L probably damaging Het
Itgad A T 7: 128,198,530 N906Y probably damaging Het
Jakmip2 T C 18: 43,577,400 E246G probably damaging Het
L3mbtl4 A T 17: 68,559,753 H329L probably damaging Het
Mau2 A G 8: 70,033,177 probably null Het
Myo16 T C 8: 10,373,474 L270P probably damaging Het
Naa25 T C 5: 121,430,692 S606P probably damaging Het
Nags T A 11: 102,146,621 C179* probably null Het
Naip2 A G 13: 100,161,536 M664T probably benign Het
Ndufv3 T C 17: 31,528,069 I311T probably benign Het
Nipsnap1 G T 11: 4,891,468 E258* probably null Het
Nudc A G 4: 133,534,349 L208P probably damaging Het
Olfr33 A T 7: 102,713,543 V290E probably damaging Het
Olfr392 T C 11: 73,814,248 Y278C probably benign Het
Oscp1 A G 4: 126,076,859 D137G possibly damaging Het
Pcdhb5 C T 18: 37,322,471 P635S probably benign Het
Pcdhgb2 T A 18: 37,692,050 I698N probably damaging Het
Pde4b A G 4: 102,597,770 Y399C probably damaging Het
Pdf A T 8: 107,048,180 V140E probably damaging Het
Ranbp2 T A 10: 58,477,056 D1199E possibly damaging Het
Rell2 G T 18: 37,956,568 probably null Het
Rgl2 A G 17: 33,937,173 H745R probably benign Het
Rnf121 A G 7: 102,023,385 C264R probably damaging Het
Rnf181 A G 6: 72,361,516 F3S probably damaging Het
Rsrc1 T A 3: 67,355,602 D296E probably damaging Het
Rubcn A T 16: 32,843,308 D319E probably damaging Het
Scaf8 T C 17: 3,178,219 S431P unknown Het
Sept11 T A 5: 93,162,253 M305K possibly damaging Het
Serpinb12 A G 1: 106,956,402 K293E probably benign Het
Sh3bp1 T A 15: 78,904,338 H229Q probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Specc1 T A 11: 62,211,684 V952E probably damaging Het
Spint2 G A 7: 29,256,786 T158I probably benign Het
St8sia4 A T 1: 95,660,898 W71R probably damaging Het
Tex48 C T 4: 63,611,914 V23I possibly damaging Het
Tmc5 G A 7: 118,645,339 G480D probably benign Het
Tmem8b T A 4: 43,689,713 M330K probably damaging Het
Tnrc18 C T 5: 142,731,340 R2453Q probably damaging Het
Trank1 A T 9: 111,391,895 N2567Y possibly damaging Het
Trps1 T C 15: 50,846,309 D211G probably damaging Het
Ttn T C 2: 76,725,159 R30501G probably damaging Het
Ttn T A 2: 76,742,903 Y25882F probably damaging Het
Unc79 T A 12: 103,173,466 V2495E probably damaging Het
Uqcr10 T A 11: 4,702,198 H58L possibly damaging Het
Usp7 A T 16: 8,756,844 C58* probably null Het
Vmn1r36 A T 6: 66,716,888 M1K probably null Het
Wdr7 T A 18: 63,777,949 M804K probably damaging Het
Zfp131 A C 13: 119,788,858 probably null Het
Zfp507 A G 7: 35,794,055 V521A probably benign Het
Other mutations in Pglyrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Pglyrp2 APN 17 32418577 missense probably benign 0.14
IGL01949:Pglyrp2 APN 17 32416106 splice site probably null
IGL02355:Pglyrp2 APN 17 32417022 missense probably damaging 1.00
IGL02362:Pglyrp2 APN 17 32417022 missense probably damaging 1.00
IGL02601:Pglyrp2 APN 17 32415861 missense probably benign 0.04
IGL02965:Pglyrp2 APN 17 32418586 missense probably benign 0.00
R0324:Pglyrp2 UTSW 17 32418328 missense probably benign 0.00
R0386:Pglyrp2 UTSW 17 32420862 start codon destroyed probably null 0.93
R2158:Pglyrp2 UTSW 17 32418248 missense probably benign 0.12
R2181:Pglyrp2 UTSW 17 32418962 missense probably damaging 1.00
R2191:Pglyrp2 UTSW 17 32415957 missense probably benign 0.04
R2313:Pglyrp2 UTSW 17 32418699 missense probably damaging 1.00
R4825:Pglyrp2 UTSW 17 32418261 missense probably benign 0.00
R4888:Pglyrp2 UTSW 17 32418797 missense probably benign 0.26
R6941:Pglyrp2 UTSW 17 32416074 missense probably damaging 1.00
R7014:Pglyrp2 UTSW 17 32415930 missense probably damaging 0.98
R7327:Pglyrp2 UTSW 17 32415919 missense probably benign 0.16
R7886:Pglyrp2 UTSW 17 32418761 missense possibly damaging 0.53
R7969:Pglyrp2 UTSW 17 32418761 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCTGAAGTTGTGTCCCAGAATAG -3'
(R):5'- CTTCCGCAGTTTCGTGGTAG -3'

Sequencing Primer
(F):5'- TTGTGTCCCAGAATAGACAGGAC -3'
(R):5'- TCCGACGGCTATCTGTACCAG -3'
Posted On2016-03-01