Incidental Mutation 'R4852:Rgl2'
ID373674
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Nameral guanine nucleotide dissociation stimulator-like 2
SynonymsKE1.5, Rab2l, Rgt2, Rlf
MMRRC Submission 042464-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4852 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33929543-33937687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33937173 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 745 (H745R)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000025170] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174048] [ENSMUST00000174426] [ENSMUST00000179418]
PDB Structure
STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025170
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
AA Change: H745R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: H745R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect unknown
Transcript: ENSMUST00000173284
AA Change: H297R
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354
AA Change: H297R

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173857
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921524L21Rik C G 18: 6,623,487 L66V possibly damaging Het
4921524L21Rik T A 18: 6,623,488 L66Q probably damaging Het
Abca6 A G 11: 110,244,203 V252A probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acap1 C T 11: 69,884,376 V354M probably benign Het
Accs T C 2: 93,844,260 D99G probably damaging Het
Adam9 T C 8: 25,003,301 Y97C probably damaging Het
Akap6 T C 12: 53,104,675 V1174A probably damaging Het
Aknad1 C A 3: 108,751,740 D23E probably damaging Het
Ano2 T C 6: 125,982,923 C666R possibly damaging Het
Atp4a G A 7: 30,724,268 A933T probably benign Het
Atxn2 T C 5: 121,814,411 L224P probably damaging Het
Bin2 T C 15: 100,645,288 E338G probably damaging Het
Bloc1s5 T C 13: 38,634,984 K20E probably damaging Het
Bst1 A T 5: 43,820,525 D72V probably benign Het
Cacna1i T C 15: 80,388,479 F1631L probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Cfap43 A G 19: 47,897,111 I355T possibly damaging Het
Chuk A T 19: 44,088,758 M383K possibly damaging Het
Cnga4 A G 7: 105,405,730 I174V probably benign Het
Cpd T C 11: 76,785,150 K1226E probably benign Het
Crip2 T C 12: 113,140,584 C5R probably damaging Het
Cyp3a11 T A 5: 145,860,495 D358V probably damaging Het
Ebag9 T C 15: 44,624,519 F21S probably damaging Het
Ercc1 A T 7: 19,350,704 H70L probably damaging Het
Exoc3 G A 13: 74,199,645 R69C probably damaging Het
Fgfr4 A T 13: 55,161,156 R363S possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm7489 T A 15: 53,886,038 probably benign Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Gpr152 G A 19: 4,143,791 V444I probably benign Het
Gss T C 2: 155,564,865 E330G probably benign Het
Hbs1l A G 10: 21,358,388 D556G possibly damaging Het
Helz2 T C 2: 181,230,120 T2619A probably damaging Het
Hk3 A G 13: 55,012,596 F304L probably damaging Het
Itgad A T 7: 128,198,530 N906Y probably damaging Het
Jakmip2 T C 18: 43,577,400 E246G probably damaging Het
L3mbtl4 A T 17: 68,559,753 H329L probably damaging Het
Mau2 A G 8: 70,033,177 probably null Het
Myo16 T C 8: 10,373,474 L270P probably damaging Het
Naa25 T C 5: 121,430,692 S606P probably damaging Het
Nags T A 11: 102,146,621 C179* probably null Het
Naip2 A G 13: 100,161,536 M664T probably benign Het
Ndufv3 T C 17: 31,528,069 I311T probably benign Het
Nipsnap1 G T 11: 4,891,468 E258* probably null Het
Nudc A G 4: 133,534,349 L208P probably damaging Het
Olfr33 A T 7: 102,713,543 V290E probably damaging Het
Olfr392 T C 11: 73,814,248 Y278C probably benign Het
Oscp1 A G 4: 126,076,859 D137G possibly damaging Het
Pcdhb5 C T 18: 37,322,471 P635S probably benign Het
Pcdhgb2 T A 18: 37,692,050 I698N probably damaging Het
Pde4b A G 4: 102,597,770 Y399C probably damaging Het
Pdf A T 8: 107,048,180 V140E probably damaging Het
Pglyrp2 T C 17: 32,415,849 N513S probably benign Het
Ranbp2 T A 10: 58,477,056 D1199E possibly damaging Het
Rell2 G T 18: 37,956,568 probably null Het
Rnf121 A G 7: 102,023,385 C264R probably damaging Het
Rnf181 A G 6: 72,361,516 F3S probably damaging Het
Rsrc1 T A 3: 67,355,602 D296E probably damaging Het
Rubcn A T 16: 32,843,308 D319E probably damaging Het
Scaf8 T C 17: 3,178,219 S431P unknown Het
Sept11 T A 5: 93,162,253 M305K possibly damaging Het
Serpinb12 A G 1: 106,956,402 K293E probably benign Het
Sh3bp1 T A 15: 78,904,338 H229Q probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Specc1 T A 11: 62,211,684 V952E probably damaging Het
Spint2 G A 7: 29,256,786 T158I probably benign Het
St8sia4 A T 1: 95,660,898 W71R probably damaging Het
Tex48 C T 4: 63,611,914 V23I possibly damaging Het
Tmc5 G A 7: 118,645,339 G480D probably benign Het
Tmem8b T A 4: 43,689,713 M330K probably damaging Het
Tnrc18 C T 5: 142,731,340 R2453Q probably damaging Het
Trank1 A T 9: 111,391,895 N2567Y possibly damaging Het
Trps1 T C 15: 50,846,309 D211G probably damaging Het
Ttn T C 2: 76,725,159 R30501G probably damaging Het
Ttn T A 2: 76,742,903 Y25882F probably damaging Het
Unc79 T A 12: 103,173,466 V2495E probably damaging Het
Uqcr10 T A 11: 4,702,198 H58L possibly damaging Het
Usp7 A T 16: 8,756,844 C58* probably null Het
Vmn1r36 A T 6: 66,716,888 M1K probably null Het
Wdr7 T A 18: 63,777,949 M804K probably damaging Het
Zfp131 A C 13: 119,788,858 probably null Het
Zfp507 A G 7: 35,794,055 V521A probably benign Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 33933136 missense probably benign 0.31
IGL00898:Rgl2 APN 17 33933418 missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 33935936 missense probably benign 0.00
IGL00985:Rgl2 APN 17 33932101 missense probably damaging 1.00
IGL02140:Rgl2 APN 17 33933124 missense probably damaging 1.00
IGL02214:Rgl2 APN 17 33935189 missense probably benign 0.06
IGL02486:Rgl2 APN 17 33935980 missense probably damaging 0.97
IGL02579:Rgl2 APN 17 33937160 missense probably benign 0.08
IGL02976:Rgl2 APN 17 33933962 missense possibly damaging 0.95
Pedernales UTSW 17 33932038 critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 33933940 missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 33932738 missense probably damaging 1.00
R0456:Rgl2 UTSW 17 33936849 splice site probably null
R0825:Rgl2 UTSW 17 33935159 splice site probably null
R1742:Rgl2 UTSW 17 33937223 unclassified probably null
R1777:Rgl2 UTSW 17 33931744 missense probably benign 0.00
R1829:Rgl2 UTSW 17 33933621 missense probably benign 0.00
R1908:Rgl2 UTSW 17 33932148 missense probably benign 0.00
R1961:Rgl2 UTSW 17 33933615 missense probably damaging 1.00
R2102:Rgl2 UTSW 17 33933340 splice site probably null
R3001:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3002:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3755:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3756:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3978:Rgl2 UTSW 17 33935162 missense probably benign 0.02
R4042:Rgl2 UTSW 17 33937262 missense probably damaging 1.00
R4064:Rgl2 UTSW 17 33937108 missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 33936932 missense probably benign 0.04
R4661:Rgl2 UTSW 17 33933226 missense possibly damaging 0.77
R4922:Rgl2 UTSW 17 33932775 unclassified probably benign
R5119:Rgl2 UTSW 17 33937120 missense probably benign 0.00
R5167:Rgl2 UTSW 17 33935974 nonsense probably null
R5279:Rgl2 UTSW 17 33935948 missense probably benign
R5319:Rgl2 UTSW 17 33933555 missense probably benign 0.02
R5337:Rgl2 UTSW 17 33934984 missense probably damaging 0.99
R5881:Rgl2 UTSW 17 33932717 missense probably benign 0.01
R5945:Rgl2 UTSW 17 33932038 critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 33931765 missense probably benign 0.01
R6358:Rgl2 UTSW 17 33937131 unclassified probably null
R6867:Rgl2 UTSW 17 33932687 missense probably benign 0.09
R7174:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7203:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7250:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7253:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7455:Rgl2 UTSW 17 33932683 missense probably benign 0.32
R7513:Rgl2 UTSW 17 33932555 missense probably benign
X0028:Rgl2 UTSW 17 33932458 unclassified probably null
Predicted Primers PCR Primer
(F):5'- CTGTGGCTTCAGAGTTCGAG -3'
(R):5'- TATTGTGGCCACCATGTGTG -3'

Sequencing Primer
(F):5'- CAGAGTTCGAGCTGGTGCAG -3'
(R):5'- GGCTGCTCACTCCTGGTATGAG -3'
Posted On2016-03-01