Incidental Mutation 'R4852:4921524L21Rik'
List |< first << previous [record 15 of 1826] next >> last >|
ID373677
Institutional Source Beutler Lab
Gene Symbol 4921524L21Rik
Ensembl Gene ENSMUSG00000039540
Gene NameRIKEN cDNA 4921524L21 gene
Synonyms
MMRRC Submission 042464-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4852 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location6603633-6638966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 6623487 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 66 (L66V)
Ref Sequence ENSEMBL: ENSMUSP00000035514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044829
AA Change: L66V

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035514
Gene: ENSMUSG00000039540
AA Change: L66V

DomainStartEndE-ValueType
Pfam:DUF3496 131 235 6.9e-12 PFAM
coiled coil region 269 292 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca6 A G 11: 110,244,203 V252A probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acap1 C T 11: 69,884,376 V354M probably benign Het
Accs T C 2: 93,844,260 D99G probably damaging Het
Adam9 T C 8: 25,003,301 Y97C probably damaging Het
Akap6 T C 12: 53,104,675 V1174A probably damaging Het
Aknad1 C A 3: 108,751,740 D23E probably damaging Het
Ano2 T C 6: 125,982,923 C666R possibly damaging Het
Atp4a G A 7: 30,724,268 A933T probably benign Het
Atxn2 T C 5: 121,814,411 L224P probably damaging Het
Bin2 T C 15: 100,645,288 E338G probably damaging Het
Bloc1s5 T C 13: 38,634,984 K20E probably damaging Het
Bst1 A T 5: 43,820,525 D72V probably benign Het
Cacna1i T C 15: 80,388,479 F1631L probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Cfap43 A G 19: 47,897,111 I355T possibly damaging Het
Chuk A T 19: 44,088,758 M383K possibly damaging Het
Cnga4 A G 7: 105,405,730 I174V probably benign Het
Cpd T C 11: 76,785,150 K1226E probably benign Het
Crip2 T C 12: 113,140,584 C5R probably damaging Het
Cyp3a11 T A 5: 145,860,495 D358V probably damaging Het
Ebag9 T C 15: 44,624,519 F21S probably damaging Het
Ercc1 A T 7: 19,350,704 H70L probably damaging Het
Exoc3 G A 13: 74,199,645 R69C probably damaging Het
Fgfr4 A T 13: 55,161,156 R363S possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm7489 T A 15: 53,886,038 probably benign Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Gpr152 G A 19: 4,143,791 V444I probably benign Het
Gss T C 2: 155,564,865 E330G probably benign Het
Hbs1l A G 10: 21,358,388 D556G possibly damaging Het
Helz2 T C 2: 181,230,120 T2619A probably damaging Het
Hk3 A G 13: 55,012,596 F304L probably damaging Het
Itgad A T 7: 128,198,530 N906Y probably damaging Het
Jakmip2 T C 18: 43,577,400 E246G probably damaging Het
L3mbtl4 A T 17: 68,559,753 H329L probably damaging Het
Mau2 A G 8: 70,033,177 probably null Het
Myo16 T C 8: 10,373,474 L270P probably damaging Het
Naa25 T C 5: 121,430,692 S606P probably damaging Het
Nags T A 11: 102,146,621 C179* probably null Het
Naip2 A G 13: 100,161,536 M664T probably benign Het
Ndufv3 T C 17: 31,528,069 I311T probably benign Het
Nipsnap1 G T 11: 4,891,468 E258* probably null Het
Nudc A G 4: 133,534,349 L208P probably damaging Het
Olfr33 A T 7: 102,713,543 V290E probably damaging Het
Olfr392 T C 11: 73,814,248 Y278C probably benign Het
Oscp1 A G 4: 126,076,859 D137G possibly damaging Het
Pcdhb5 C T 18: 37,322,471 P635S probably benign Het
Pcdhgb2 T A 18: 37,692,050 I698N probably damaging Het
Pde4b A G 4: 102,597,770 Y399C probably damaging Het
Pdf A T 8: 107,048,180 V140E probably damaging Het
Pglyrp2 T C 17: 32,415,849 N513S probably benign Het
Ranbp2 T A 10: 58,477,056 D1199E possibly damaging Het
Rell2 G T 18: 37,956,568 probably null Het
Rgl2 A G 17: 33,937,173 H745R probably benign Het
Rnf121 A G 7: 102,023,385 C264R probably damaging Het
Rnf181 A G 6: 72,361,516 F3S probably damaging Het
Rsrc1 T A 3: 67,355,602 D296E probably damaging Het
Rubcn A T 16: 32,843,308 D319E probably damaging Het
Scaf8 T C 17: 3,178,219 S431P unknown Het
Sept11 T A 5: 93,162,253 M305K possibly damaging Het
Serpinb12 A G 1: 106,956,402 K293E probably benign Het
Sh3bp1 T A 15: 78,904,338 H229Q probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Specc1 T A 11: 62,211,684 V952E probably damaging Het
Spint2 G A 7: 29,256,786 T158I probably benign Het
St8sia4 A T 1: 95,660,898 W71R probably damaging Het
Tex48 C T 4: 63,611,914 V23I possibly damaging Het
Tmc5 G A 7: 118,645,339 G480D probably benign Het
Tmem8b T A 4: 43,689,713 M330K probably damaging Het
Tnrc18 C T 5: 142,731,340 R2453Q probably damaging Het
Trank1 A T 9: 111,391,895 N2567Y possibly damaging Het
Trps1 T C 15: 50,846,309 D211G probably damaging Het
Ttn T C 2: 76,725,159 R30501G probably damaging Het
Ttn T A 2: 76,742,903 Y25882F probably damaging Het
Unc79 T A 12: 103,173,466 V2495E probably damaging Het
Uqcr10 T A 11: 4,702,198 H58L possibly damaging Het
Usp7 A T 16: 8,756,844 C58* probably null Het
Vmn1r36 A T 6: 66,716,888 M1K probably null Het
Wdr7 T A 18: 63,777,949 M804K probably damaging Het
Zfp131 A C 13: 119,788,858 probably null Het
Zfp507 A G 7: 35,794,055 V521A probably benign Het
Other mutations in 4921524L21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:4921524L21Rik APN 18 6629578 missense possibly damaging 0.93
IGL01402:4921524L21Rik APN 18 6638653 missense possibly damaging 0.65
IGL01404:4921524L21Rik APN 18 6638653 missense possibly damaging 0.65
IGL02680:4921524L21Rik APN 18 6635949 splice site probably benign
R0532:4921524L21Rik UTSW 18 6638618 missense possibly damaging 0.83
R1069:4921524L21Rik UTSW 18 6624037 missense probably benign 0.01
R1706:4921524L21Rik UTSW 18 6624059 splice site probably benign
R1768:4921524L21Rik UTSW 18 6623470 missense possibly damaging 0.72
R1912:4921524L21Rik UTSW 18 6620205 missense possibly damaging 0.72
R3820:4921524L21Rik UTSW 18 6630166 critical splice donor site probably null
R3840:4921524L21Rik UTSW 18 6620104 missense probably benign 0.44
R3841:4921524L21Rik UTSW 18 6620104 missense probably benign 0.44
R4201:4921524L21Rik UTSW 18 6623952 critical splice acceptor site probably null
R4852:4921524L21Rik UTSW 18 6623488 missense probably damaging 0.99
R5218:4921524L21Rik UTSW 18 6629628 missense possibly damaging 0.63
R5389:4921524L21Rik UTSW 18 6638795 missense probably benign 0.14
R5428:4921524L21Rik UTSW 18 6635918 missense probably benign 0.04
R5873:4921524L21Rik UTSW 18 6630167 critical splice donor site probably null
R6120:4921524L21Rik UTSW 18 6638795 missense possibly damaging 0.85
R6345:4921524L21Rik UTSW 18 6626399 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACATACTTCTTCCAGTAGGTGCC -3'
(R):5'- CAAGCTATTTGGTTGCTCTATCAC -3'

Sequencing Primer
(F):5'- TAGGTGCCATCTGTGCTGCATAC -3'
(R):5'- AACCAGGGCCTTACATTGTG -3'
Posted On2016-03-01