Incidental Mutation 'R4853:Adcy10'
ID373689
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Nameadenylate cyclase 10
SynonymssAC, Sacy, soluble adenylyl cyclase
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R4853 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location165485183-165576774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 165548213 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 803 (N803K)
Ref Sequence ENSEMBL: ENSMUSP00000107067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
Predicted Effect probably benign
Transcript: ENSMUST00000027852
AA Change: N803K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: N803K

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111439
AA Change: N803K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: N803K

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111440
AA Change: N803K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: N803K

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124037
Predicted Effect probably benign
Transcript: ENSMUST00000148550
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195194
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Abr T C 11: 76,464,261 T244A probably damaging Het
Afm T C 5: 90,551,467 F590S probably damaging Het
Agk T C 6: 40,383,819 probably null Het
Agrn C T 4: 156,185,550 probably null Het
AI481877 T C 4: 59,072,345 K624E possibly damaging Het
Apon A G 10: 128,255,082 S210G probably benign Het
Atad5 A G 11: 80,095,272 E395G probably damaging Het
AU018091 A T 7: 3,156,021 L671H probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Ccdc154 A T 17: 25,170,967 I524F probably damaging Het
Clspn T A 4: 126,566,555 I525K probably damaging Het
Cpne5 A T 17: 29,161,198 V448E probably benign Het
Cps1 A G 1: 67,156,202 I261V possibly damaging Het
Crybb2 T C 5: 113,063,188 E78G probably damaging Het
Ctps G T 4: 120,554,010 L270I probably damaging Het
Cyp19a1 T C 9: 54,166,776 D431G probably benign Het
Cyp3a57 T G 5: 145,365,679 V95G probably damaging Het
Ddx54 A G 5: 120,623,629 D490G probably benign Het
Dnaic2 A T 11: 114,745,091 I301F probably benign Het
Dsg1b A G 18: 20,408,736 S767G probably benign Het
Dsg1b A T 18: 20,390,132 probably null Het
Ermap G A 4: 119,187,254 P115L probably damaging Het
Esrra T G 19: 6,920,072 T106P probably damaging Het
Exoc5 GTATT GT 14: 49,052,369 probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gnl3 T C 14: 31,015,313 K203E probably damaging Het
Habp2 G A 19: 56,311,191 probably null Het
Hist1h2ai A G 13: 21,716,696 E92G probably damaging Het
Kcnh3 A C 15: 99,242,089 D952A possibly damaging Het
Kif27 T C 13: 58,311,258 K920E probably benign Het
Kmt2e C T 5: 23,502,341 P1634L probably damaging Het
Lamc1 A T 1: 153,229,100 M1312K possibly damaging Het
Myh14 T A 7: 44,608,448 Q1921L probably damaging Het
Ncor2 A G 5: 125,025,105 V68A probably damaging Het
Ncor2 A G 5: 125,081,183 F444L unknown Het
Nedd9 A G 13: 41,316,361 Y439H probably benign Het
Nsd1 T A 13: 55,268,504 H1454Q probably benign Het
Olfr1160 A G 2: 88,006,104 S216P probably damaging Het
Olfr1418 T A 19: 11,855,281 D224V probably benign Het
Olfr152 T G 2: 87,783,182 F214C probably benign Het
Olfr624 G T 7: 103,670,803 T76K probably damaging Het
P4ha2 G A 11: 54,120,170 S337N probably benign Het
Pck1 T A 2: 173,154,714 Y140* probably null Het
Phldb2 T C 16: 45,802,716 M656V probably damaging Het
Pif1 T C 9: 65,593,576 W559R probably damaging Het
Pllp T C 8: 94,679,394 Y87C probably damaging Het
Ppp1r3a T C 6: 14,719,047 N623D probably benign Het
Prkcg C T 7: 3,318,953 R345C probably damaging Het
Rgl1 T C 1: 152,557,574 I147V probably benign Het
Sdk1 T A 5: 142,146,263 L1649Q probably damaging Het
Sema3b C T 9: 107,602,067 probably null Het
Sh3rf3 G A 10: 59,083,519 R486H probably damaging Het
Slain2 A G 5: 72,948,598 N192S probably benign Het
Slc22a16 T A 10: 40,574,051 I161N probably damaging Het
Strip1 T C 3: 107,616,916 K562E possibly damaging Het
Sumf1 A G 6: 108,185,495 L21S probably benign Het
Sytl3 T A 17: 6,737,765 S380T probably damaging Het
Tgfb1i1 T A 7: 128,248,668 C74* probably null Het
Tmprss15 T G 16: 78,960,591 I939L probably benign Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Vwde A T 6: 13,215,640 V139E probably damaging Het
Wdr27 A G 17: 14,917,213 probably null Het
Zkscan14 A G 5: 145,195,191 V510A probably benign Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165551914 missense probably benign 0.45
IGL00731:Adcy10 APN 1 165572614 missense probably benign
IGL01099:Adcy10 APN 1 165539842 missense probably benign 0.21
IGL01464:Adcy10 APN 1 165546587 missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165513168 critical splice donor site probably null
IGL02002:Adcy10 APN 1 165521843 missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165570620 missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165572543 missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165559128 missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165538380 missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165510408 missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165570744 missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165567726 missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165543233 missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165519518 missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165538475 nonsense probably null
PIT4514001:Adcy10 UTSW 1 165556791 missense probably benign 0.28
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165572591 missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165564249 missense probably benign 0.00
R0433:Adcy10 UTSW 1 165552022 missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165570728 missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165510390 missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165519519 missense probably benign 0.04
R0533:Adcy10 UTSW 1 165564023 missense probably benign 0.05
R0550:Adcy10 UTSW 1 165565315 missense probably benign 0.00
R0554:Adcy10 UTSW 1 165513130 missense probably benign
R0597:Adcy10 UTSW 1 165525062 critical splice donor site probably null
R0629:Adcy10 UTSW 1 165543105 missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165563947 missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165515380 missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165518403 missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165518312 missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165525033 missense probably benign 0.02
R1690:Adcy10 UTSW 1 165519925 missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165503243 missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165521961 missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165570808 missense probably benign 0.02
R1929:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165525022 missense probably benign 0.02
R2211:Adcy10 UTSW 1 165518212 missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165558597 missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165575727 missense probably benign 0.38
R4538:Adcy10 UTSW 1 165513127 missense probably benign 0.38
R4644:Adcy10 UTSW 1 165551361 critical splice donor site probably null
R4649:Adcy10 UTSW 1 165504049 missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165506644 missense probably damaging 1.00
R4916:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165563963 missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165556862 missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165519500 missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165519895 missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165513140 missense probably benign 0.43
R5692:Adcy10 UTSW 1 165515306 missense probably benign 0.36
R5949:Adcy10 UTSW 1 165539817 missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165541649 missense probably benign 0.19
R6238:Adcy10 UTSW 1 165575728 nonsense probably null
R6455:Adcy10 UTSW 1 165518374 missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165575658 missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165506635 missense probably benign 0.21
R6957:Adcy10 UTSW 1 165564285 missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165556916 missense probably benign 0.02
R7027:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165539874 missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165538522 missense probably benign 0.27
R7130:Adcy10 UTSW 1 165504047 missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165510370 missense probably benign 0.01
R7182:Adcy10 UTSW 1 165543470 intron probably null
R7228:Adcy10 UTSW 1 165510272 missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165576608 missense unknown
R7561:Adcy10 UTSW 1 165559172 missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165564237 missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165570771 missense probably benign 0.01
R7812:Adcy10 UTSW 1 165515369 missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R7988:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R8040:Adcy10 UTSW 1 165552024 missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165552109 missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165510276 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTTCTAGAACACTTGGTGAACCAG -3'
(R):5'- ACTGGATGACCTGTCTCCTG -3'

Sequencing Primer
(F):5'- GTGAACCAGTACGTCTCTGCTTAG -3'
(R):5'- GAGAAGGGGATGCTACTT -3'
Posted On2016-03-01