Incidental Mutation 'R4853:Olfr1160'
ID373691
Institutional Source Beutler Lab
Gene Symbol Olfr1160
Ensembl Gene ENSMUSG00000075141
Gene Nameolfactory receptor 1160
SynonymsMOR173-1, GA_x6K02T2Q125-49498697-49497765
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4853 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88000927-88008268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88006104 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 216 (S216P)
Ref Sequence ENSEMBL: ENSMUSP00000148857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099839] [ENSMUST00000215457]
Predicted Effect probably damaging
Transcript: ENSMUST00000099839
AA Change: S225P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097427
Gene: ENSMUSG00000075141
AA Change: S225P

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 1.2e-46 PFAM
Pfam:7tm_1 50 298 2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215457
AA Change: S216P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Abr T C 11: 76,464,261 T244A probably damaging Het
Adcy10 T A 1: 165,548,213 N803K probably benign Het
Afm T C 5: 90,551,467 F590S probably damaging Het
Agk T C 6: 40,383,819 probably null Het
Agrn C T 4: 156,185,550 probably null Het
AI481877 T C 4: 59,072,345 K624E possibly damaging Het
Apon A G 10: 128,255,082 S210G probably benign Het
Atad5 A G 11: 80,095,272 E395G probably damaging Het
AU018091 A T 7: 3,156,021 L671H probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Ccdc154 A T 17: 25,170,967 I524F probably damaging Het
Clspn T A 4: 126,566,555 I525K probably damaging Het
Cpne5 A T 17: 29,161,198 V448E probably benign Het
Cps1 A G 1: 67,156,202 I261V possibly damaging Het
Crybb2 T C 5: 113,063,188 E78G probably damaging Het
Ctps G T 4: 120,554,010 L270I probably damaging Het
Cyp19a1 T C 9: 54,166,776 D431G probably benign Het
Cyp3a57 T G 5: 145,365,679 V95G probably damaging Het
Ddx54 A G 5: 120,623,629 D490G probably benign Het
Dnaic2 A T 11: 114,745,091 I301F probably benign Het
Dsg1b A G 18: 20,408,736 S767G probably benign Het
Dsg1b A T 18: 20,390,132 probably null Het
Ermap G A 4: 119,187,254 P115L probably damaging Het
Esrra T G 19: 6,920,072 T106P probably damaging Het
Exoc5 GTATT GT 14: 49,052,369 probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gnl3 T C 14: 31,015,313 K203E probably damaging Het
Habp2 G A 19: 56,311,191 probably null Het
Hist1h2ai A G 13: 21,716,696 E92G probably damaging Het
Kcnh3 A C 15: 99,242,089 D952A possibly damaging Het
Kif27 T C 13: 58,311,258 K920E probably benign Het
Kmt2e C T 5: 23,502,341 P1634L probably damaging Het
Lamc1 A T 1: 153,229,100 M1312K possibly damaging Het
Myh14 T A 7: 44,608,448 Q1921L probably damaging Het
Ncor2 A G 5: 125,025,105 V68A probably damaging Het
Ncor2 A G 5: 125,081,183 F444L unknown Het
Nedd9 A G 13: 41,316,361 Y439H probably benign Het
Nsd1 T A 13: 55,268,504 H1454Q probably benign Het
Olfr1418 T A 19: 11,855,281 D224V probably benign Het
Olfr152 T G 2: 87,783,182 F214C probably benign Het
Olfr624 G T 7: 103,670,803 T76K probably damaging Het
P4ha2 G A 11: 54,120,170 S337N probably benign Het
Pck1 T A 2: 173,154,714 Y140* probably null Het
Phldb2 T C 16: 45,802,716 M656V probably damaging Het
Pif1 T C 9: 65,593,576 W559R probably damaging Het
Pllp T C 8: 94,679,394 Y87C probably damaging Het
Ppp1r3a T C 6: 14,719,047 N623D probably benign Het
Prkcg C T 7: 3,318,953 R345C probably damaging Het
Rgl1 T C 1: 152,557,574 I147V probably benign Het
Sdk1 T A 5: 142,146,263 L1649Q probably damaging Het
Sema3b C T 9: 107,602,067 probably null Het
Sh3rf3 G A 10: 59,083,519 R486H probably damaging Het
Slain2 A G 5: 72,948,598 N192S probably benign Het
Slc22a16 T A 10: 40,574,051 I161N probably damaging Het
Strip1 T C 3: 107,616,916 K562E possibly damaging Het
Sumf1 A G 6: 108,185,495 L21S probably benign Het
Sytl3 T A 17: 6,737,765 S380T probably damaging Het
Tgfb1i1 T A 7: 128,248,668 C74* probably null Het
Tmprss15 T G 16: 78,960,591 I939L probably benign Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Vwde A T 6: 13,215,640 V139E probably damaging Het
Wdr27 A G 17: 14,917,213 probably null Het
Zkscan14 A G 5: 145,195,191 V510A probably benign Het
Other mutations in Olfr1160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Olfr1160 APN 2 88006644 missense probably damaging 1.00
IGL01321:Olfr1160 APN 2 88006245 missense probably damaging 0.97
IGL02009:Olfr1160 APN 2 88006773 missense probably benign
IGL03409:Olfr1160 APN 2 88005895 missense probably damaging 1.00
R0089:Olfr1160 UTSW 2 88005987 missense probably damaging 1.00
R0685:Olfr1160 UTSW 2 88006418 missense probably damaging 1.00
R1416:Olfr1160 UTSW 2 88006571 missense probably damaging 1.00
R1852:Olfr1160 UTSW 2 88006521 missense probably damaging 1.00
R1965:Olfr1160 UTSW 2 88006304 missense probably damaging 1.00
R2206:Olfr1160 UTSW 2 88006235 missense probably benign 0.00
R5599:Olfr1160 UTSW 2 88006005 missense probably benign 0.44
R6851:Olfr1160 UTSW 2 88005956 missense probably damaging 0.98
R6995:Olfr1160 UTSW 2 88006185 missense probably benign 0.00
R7817:Olfr1160 UTSW 2 88006011 missense probably benign
Z1176:Olfr1160 UTSW 2 88006437 missense probably damaging 0.98
Z31818:Olfr1160 UTSW 2 88005890 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGGGATTAAGCATGGGTATAATC -3'
(R):5'- CAAGAGAGTCTGTATTCAGTTGGC -3'

Sequencing Primer
(F):5'- GTATAGAACACAGAGGTCATTTTGTC -3'
(R):5'- CAGTTGGCATTTGGAGCATTC -3'
Posted On2016-03-01