Incidental Mutation 'R4853:Ermap'
ID373696
Institutional Source Beutler Lab
Gene Symbol Ermap
Ensembl Gene ENSMUSG00000028644
Gene Nameerythroblast membrane-associated protein
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4853 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location119175457-119190011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119187254 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 115 (P115L)
Ref Sequence ENSEMBL: ENSMUSP00000123426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030396] [ENSMUST00000124626] [ENSMUST00000133956] [ENSMUST00000138395] [ENSMUST00000141227] [ENSMUST00000150864] [ENSMUST00000156746]
Predicted Effect probably damaging
Transcript: ENSMUST00000030396
AA Change: P115L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030396
Gene: ENSMUSG00000028644
AA Change: P115L

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
Blast:IG_like 174 260 1e-19 BLAST
transmembrane domain 272 294 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124626
AA Change: P115L

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120202
Gene: ENSMUSG00000028644
AA Change: P115L

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127574
Predicted Effect probably damaging
Transcript: ENSMUST00000133956
AA Change: P89L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120181
Gene: ENSMUSG00000028644
AA Change: P89L

DomainStartEndE-ValueType
IGv 42 125 9.26e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137080
Predicted Effect probably damaging
Transcript: ENSMUST00000138395
AA Change: P115L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123426
Gene: ENSMUSG00000028644
AA Change: P115L

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
transmembrane domain 272 294 N/A INTRINSIC
coiled coil region 304 342 N/A INTRINSIC
PRY 354 406 1.15e-27 SMART
SPRY 407 532 3.25e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141227
Predicted Effect probably benign
Transcript: ENSMUST00000150864
Predicted Effect probably benign
Transcript: ENSMUST00000156746
SMART Domains Protein: ENSMUSP00000118640
Gene: ENSMUSG00000028644

DomainStartEndE-ValueType
Blast:IG 78 107 6e-14 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell surface transmembrane protein that may act as an erythroid cell receptor, possibly as a mediator of cell adhesion. Polymorphisms in this gene are responsible for the Scianna/Radin blood group system. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Abr T C 11: 76,464,261 T244A probably damaging Het
Adcy10 T A 1: 165,548,213 N803K probably benign Het
Afm T C 5: 90,551,467 F590S probably damaging Het
Agk T C 6: 40,383,819 probably null Het
Agrn C T 4: 156,185,550 probably null Het
AI481877 T C 4: 59,072,345 K624E possibly damaging Het
Apon A G 10: 128,255,082 S210G probably benign Het
Atad5 A G 11: 80,095,272 E395G probably damaging Het
AU018091 A T 7: 3,156,021 L671H probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Ccdc154 A T 17: 25,170,967 I524F probably damaging Het
Clspn T A 4: 126,566,555 I525K probably damaging Het
Cpne5 A T 17: 29,161,198 V448E probably benign Het
Cps1 A G 1: 67,156,202 I261V possibly damaging Het
Crybb2 T C 5: 113,063,188 E78G probably damaging Het
Ctps G T 4: 120,554,010 L270I probably damaging Het
Cyp19a1 T C 9: 54,166,776 D431G probably benign Het
Cyp3a57 T G 5: 145,365,679 V95G probably damaging Het
Ddx54 A G 5: 120,623,629 D490G probably benign Het
Dnaic2 A T 11: 114,745,091 I301F probably benign Het
Dsg1b A G 18: 20,408,736 S767G probably benign Het
Dsg1b A T 18: 20,390,132 probably null Het
Esrra T G 19: 6,920,072 T106P probably damaging Het
Exoc5 GTATT GT 14: 49,052,369 probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gnl3 T C 14: 31,015,313 K203E probably damaging Het
Habp2 G A 19: 56,311,191 probably null Het
Hist1h2ai A G 13: 21,716,696 E92G probably damaging Het
Kcnh3 A C 15: 99,242,089 D952A possibly damaging Het
Kif27 T C 13: 58,311,258 K920E probably benign Het
Kmt2e C T 5: 23,502,341 P1634L probably damaging Het
Lamc1 A T 1: 153,229,100 M1312K possibly damaging Het
Myh14 T A 7: 44,608,448 Q1921L probably damaging Het
Ncor2 A G 5: 125,025,105 V68A probably damaging Het
Ncor2 A G 5: 125,081,183 F444L unknown Het
Nedd9 A G 13: 41,316,361 Y439H probably benign Het
Nsd1 T A 13: 55,268,504 H1454Q probably benign Het
Olfr1160 A G 2: 88,006,104 S216P probably damaging Het
Olfr1418 T A 19: 11,855,281 D224V probably benign Het
Olfr152 T G 2: 87,783,182 F214C probably benign Het
Olfr624 G T 7: 103,670,803 T76K probably damaging Het
P4ha2 G A 11: 54,120,170 S337N probably benign Het
Pck1 T A 2: 173,154,714 Y140* probably null Het
Phldb2 T C 16: 45,802,716 M656V probably damaging Het
Pif1 T C 9: 65,593,576 W559R probably damaging Het
Pllp T C 8: 94,679,394 Y87C probably damaging Het
Ppp1r3a T C 6: 14,719,047 N623D probably benign Het
Prkcg C T 7: 3,318,953 R345C probably damaging Het
Rgl1 T C 1: 152,557,574 I147V probably benign Het
Sdk1 T A 5: 142,146,263 L1649Q probably damaging Het
Sema3b C T 9: 107,602,067 probably null Het
Sh3rf3 G A 10: 59,083,519 R486H probably damaging Het
Slain2 A G 5: 72,948,598 N192S probably benign Het
Slc22a16 T A 10: 40,574,051 I161N probably damaging Het
Strip1 T C 3: 107,616,916 K562E possibly damaging Het
Sumf1 A G 6: 108,185,495 L21S probably benign Het
Sytl3 T A 17: 6,737,765 S380T probably damaging Het
Tgfb1i1 T A 7: 128,248,668 C74* probably null Het
Tmprss15 T G 16: 78,960,591 I939L probably benign Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Vwde A T 6: 13,215,640 V139E probably damaging Het
Wdr27 A G 17: 14,917,213 probably null Het
Zkscan14 A G 5: 145,195,191 V510A probably benign Het
Other mutations in Ermap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ermap APN 4 119183917 missense probably damaging 1.00
IGL01402:Ermap APN 4 119187158 missense probably damaging 1.00
IGL02471:Ermap APN 4 119179963 missense probably damaging 0.99
IGL02696:Ermap APN 4 119187707 missense possibly damaging 0.89
IGL02806:Ermap APN 4 119188916 missense possibly damaging 0.91
R0017:Ermap UTSW 4 119179948 splice site probably benign
R0645:Ermap UTSW 4 119185691 missense probably benign 0.04
R0737:Ermap UTSW 4 119178510 missense probably damaging 1.00
R1204:Ermap UTSW 4 119188867 missense possibly damaging 0.91
R1239:Ermap UTSW 4 119188925 missense probably benign
R1351:Ermap UTSW 4 119181361 splice site probably null
R1597:Ermap UTSW 4 119183955 missense probably damaging 1.00
R4128:Ermap UTSW 4 119187111 missense possibly damaging 0.89
R4588:Ermap UTSW 4 119188248 intron probably benign
R4906:Ermap UTSW 4 119188818 intron probably benign
R4946:Ermap UTSW 4 119183308 missense probably damaging 1.00
R5187:Ermap UTSW 4 119185818 critical splice acceptor site probably null
R6275:Ermap UTSW 4 119178550 missense probably damaging 1.00
R6301:Ermap UTSW 4 119185603 missense probably damaging 1.00
R6458:Ermap UTSW 4 119178140 missense probably damaging 1.00
R6896:Ermap UTSW 4 119187131 nonsense probably null
R6997:Ermap UTSW 4 119178613 missense probably damaging 1.00
R7445:Ermap UTSW 4 119188710 missense unknown
Z1177:Ermap UTSW 4 119185561 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAGTCAGGGTTTCACTAAGTTG -3'
(R):5'- TGGCAAGGTCTACATAGCCC -3'

Sequencing Primer
(F):5'- CAGGGTTTCACTAAGTTGAATGGAC -3'
(R):5'- AAGGTCTACATAGCCCCTCTTAGG -3'
Posted On2016-03-01