Mutagenetix > Incidental Mutation

Incidental Mutation 'R4853:Clspn'

373698

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4853 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 126566555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 525 (I525K)

Ref Sequence

ENSEMBL: ENSMUSP00000045344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391] [ENSMUST00000129795]

AlphaFold

Q80YR7

Predicted Effect

probably damaging
Transcript: ENSMUST00000048391
AA Change: I525K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: I525K

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123695

Predicted Effect

probably benign
Transcript: ENSMUST00000126512

SMART Domains

Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
coiled coil region	74	101	N/A	INTRINSIC
low complexity region	108	147	N/A	INTRINSIC
low complexity region	153	170	N/A	INTRINSIC
low complexity region	221	242	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129795

SMART Domains

Protein: ENSMUSP00000120683
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
low complexity region	50	66	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim2	C	T	5: 35,802,422	R73C	possibly damaging	Het
Abr	T	C	11: 76,464,261	T244A	probably damaging	Het
Adcy10	T	A	1: 165,548,213	N803K	probably benign	Het
Afm	T	C	5: 90,551,467	F590S	probably damaging	Het
Agk	T	C	6: 40,383,819		probably null	Het
Agrn	C	T	4: 156,185,550		probably null	Het
AI481877	T	C	4: 59,072,345	K624E	possibly damaging	Het
Apon	A	G	10: 128,255,082	S210G	probably benign	Het
Atad5	A	G	11: 80,095,272	E395G	probably damaging	Het
AU018091	A	T	7: 3,156,021	L671H	probably damaging	Het
Capn13	GCA	G	17: 73,351,506		probably null	Het
Ccdc154	A	T	17: 25,170,967	I524F	probably damaging	Het
Cpne5	A	T	17: 29,161,198	V448E	probably benign	Het
Cps1	A	G	1: 67,156,202	I261V	possibly damaging	Het
Crybb2	T	C	5: 113,063,188	E78G	probably damaging	Het
Ctps	G	T	4: 120,554,010	L270I	probably damaging	Het
Cyp19a1	T	C	9: 54,166,776	D431G	probably benign	Het
Cyp3a57	T	G	5: 145,365,679	V95G	probably damaging	Het
Ddx54	A	G	5: 120,623,629	D490G	probably benign	Het
Dnaic2	A	T	11: 114,745,091	I301F	probably benign	Het
Dsg1b	A	G	18: 20,408,736	S767G	probably benign	Het
Dsg1b	A	T	18: 20,390,132		probably null	Het
Ermap	G	A	4: 119,187,254	P115L	probably damaging	Het
Esrra	T	G	19: 6,920,072	T106P	probably damaging	Het
Exoc5	GTATT	GT	14: 49,052,369		probably benign	Het
Flt1	C	A	5: 147,683,939	A132S	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gnl3	T	C	14: 31,015,313	K203E	probably damaging	Het
Habp2	G	A	19: 56,311,191		probably null	Het
Hist1h2ai	A	G	13: 21,716,696	E92G	probably damaging	Het
Kcnh3	A	C	15: 99,242,089	D952A	possibly damaging	Het
Kif27	T	C	13: 58,311,258	K920E	probably benign	Het
Kmt2e	C	T	5: 23,502,341	P1634L	probably damaging	Het
Lamc1	A	T	1: 153,229,100	M1312K	possibly damaging	Het
Myh14	T	A	7: 44,608,448	Q1921L	probably damaging	Het
Ncor2	A	G	5: 125,025,105	V68A	probably damaging	Het
Ncor2	A	G	5: 125,081,183	F444L	unknown	Het
Nedd9	A	G	13: 41,316,361	Y439H	probably benign	Het
Nsd1	T	A	13: 55,268,504	H1454Q	probably benign	Het
Olfr1160	A	G	2: 88,006,104	S216P	probably damaging	Het
Olfr1418	T	A	19: 11,855,281	D224V	probably benign	Het
Olfr152	T	G	2: 87,783,182	F214C	probably benign	Het
Olfr624	G	T	7: 103,670,803	T76K	probably damaging	Het
P4ha2	G	A	11: 54,120,170	S337N	probably benign	Het
Pck1	T	A	2: 173,154,714	Y140*	probably null	Het
Phldb2	T	C	16: 45,802,716	M656V	probably damaging	Het
Pif1	T	C	9: 65,593,576	W559R	probably damaging	Het
Pllp	T	C	8: 94,679,394	Y87C	probably damaging	Het
Ppp1r3a	T	C	6: 14,719,047	N623D	probably benign	Het
Prkcg	C	T	7: 3,318,953	R345C	probably damaging	Het
Rgl1	T	C	1: 152,557,574	I147V	probably benign	Het
Sdk1	T	A	5: 142,146,263	L1649Q	probably damaging	Het
Sema3b	C	T	9: 107,602,067		probably null	Het
Sh3rf3	G	A	10: 59,083,519	R486H	probably damaging	Het
Slain2	A	G	5: 72,948,598	N192S	probably benign	Het
Slc22a16	T	A	10: 40,574,051	I161N	probably damaging	Het
Strip1	T	C	3: 107,616,916	K562E	possibly damaging	Het
Sumf1	A	G	6: 108,185,495	L21S	probably benign	Het
Sytl3	T	A	17: 6,737,765	S380T	probably damaging	Het
Tgfb1i1	T	A	7: 128,248,668	C74*	probably null	Het
Tmprss15	T	G	16: 78,960,591	I939L	probably benign	Het
Tpsb2	GGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTG	17: 25,366,562		probably benign	Het
Vwde	A	T	6: 13,215,640	V139E	probably damaging	Het
Wdr27	A	G	17: 14,917,213		probably null	Het
Zkscan14	A	G	5: 145,195,191	V510A	probably benign	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9106:Clspn	UTSW	4	126577450	intron	probably benign
R9223:Clspn	UTSW	4	126590618	missense	possibly damaging	0.60
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
R9527:Clspn	UTSW	4	126559999	nonsense	probably null
R9717:Clspn	UTSW	4	126564963	missense	possibly damaging	0.90
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAGACCTCACCGAATCTGAC -3'
(R):5'- ATCTGAACAGGATTCTGCCCAC -3'

Sequencing Primer
(F):5'- ACCGAATCTGACCCTCCTG -3'
(R):5'- GAACAGGATTCTGCCCACTTCTAG -3'

Posted On

2016-03-01