Incidental Mutation 'R4853:Gas2l3'
ID373727
Institutional Source Beutler Lab
Gene Symbol Gas2l3
Ensembl Gene ENSMUSG00000074802
Gene Namegrowth arrest-specific 2 like 3
Synonyms8430435B07Rik, LOC237436
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R4853 (G1)
Quality Score217
Status Not validated
Chromosome10
Chromosomal Location89408823-89443967 bp(-) (GRCm38)
Type of Mutationsmall deletion (3 aa in frame mutation)
DNA Base Change (assembly) CACTCGTCATACT to CACT at 89430958 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099374] [ENSMUST00000105298] [ENSMUST00000218764] [ENSMUST00000219351] [ENSMUST00000220071] [ENSMUST00000220128] [ENSMUST00000220234]
Predicted Effect probably benign
Transcript: ENSMUST00000099374
SMART Domains Protein: ENSMUSP00000096973
Gene: ENSMUSG00000074802

DomainStartEndE-ValueType
CH 52 166 1.71e-9 SMART
low complexity region 179 194 N/A INTRINSIC
Pfam:GAS2 215 284 1.8e-29 PFAM
low complexity region 446 460 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105298
SMART Domains Protein: ENSMUSP00000100935
Gene: ENSMUSG00000074802

DomainStartEndE-ValueType
CH 52 166 1.71e-9 SMART
low complexity region 179 194 N/A INTRINSIC
Pfam:GAS2 213 286 1.5e-31 PFAM
low complexity region 446 460 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219073
Predicted Effect probably benign
Transcript: ENSMUST00000219351
Predicted Effect probably benign
Transcript: ENSMUST00000220071
Predicted Effect probably benign
Transcript: ENSMUST00000220128
Predicted Effect probably benign
Transcript: ENSMUST00000220234
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial postnatal lethality with none surviving past 4 months, dilated cardiomyopathy, cardiac interstitial fibrosis, and premature binucleation of cardiomyocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Abr T C 11: 76,464,261 T244A probably damaging Het
Adcy10 T A 1: 165,548,213 N803K probably benign Het
Afm T C 5: 90,551,467 F590S probably damaging Het
Agk T C 6: 40,383,819 probably null Het
Agrn C T 4: 156,185,550 probably null Het
AI481877 T C 4: 59,072,345 K624E possibly damaging Het
Apon A G 10: 128,255,082 S210G probably benign Het
Atad5 A G 11: 80,095,272 E395G probably damaging Het
AU018091 A T 7: 3,156,021 L671H probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Ccdc154 A T 17: 25,170,967 I524F probably damaging Het
Clspn T A 4: 126,566,555 I525K probably damaging Het
Cpne5 A T 17: 29,161,198 V448E probably benign Het
Cps1 A G 1: 67,156,202 I261V possibly damaging Het
Crybb2 T C 5: 113,063,188 E78G probably damaging Het
Ctps G T 4: 120,554,010 L270I probably damaging Het
Cyp19a1 T C 9: 54,166,776 D431G probably benign Het
Cyp3a57 T G 5: 145,365,679 V95G probably damaging Het
Ddx54 A G 5: 120,623,629 D490G probably benign Het
Dnaic2 A T 11: 114,745,091 I301F probably benign Het
Dsg1b A G 18: 20,408,736 S767G probably benign Het
Dsg1b A T 18: 20,390,132 probably null Het
Ermap G A 4: 119,187,254 P115L probably damaging Het
Esrra T G 19: 6,920,072 T106P probably damaging Het
Exoc5 GTATT GT 14: 49,052,369 probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gnl3 T C 14: 31,015,313 K203E probably damaging Het
Habp2 G A 19: 56,311,191 probably null Het
Hist1h2ai A G 13: 21,716,696 E92G probably damaging Het
Kcnh3 A C 15: 99,242,089 D952A possibly damaging Het
Kif27 T C 13: 58,311,258 K920E probably benign Het
Kmt2e C T 5: 23,502,341 P1634L probably damaging Het
Lamc1 A T 1: 153,229,100 M1312K possibly damaging Het
Myh14 T A 7: 44,608,448 Q1921L probably damaging Het
Ncor2 A G 5: 125,025,105 V68A probably damaging Het
Ncor2 A G 5: 125,081,183 F444L unknown Het
Nedd9 A G 13: 41,316,361 Y439H probably benign Het
Nsd1 T A 13: 55,268,504 H1454Q probably benign Het
Olfr1160 A G 2: 88,006,104 S216P probably damaging Het
Olfr1418 T A 19: 11,855,281 D224V probably benign Het
Olfr152 T G 2: 87,783,182 F214C probably benign Het
Olfr624 G T 7: 103,670,803 T76K probably damaging Het
P4ha2 G A 11: 54,120,170 S337N probably benign Het
Pck1 T A 2: 173,154,714 Y140* probably null Het
Phldb2 T C 16: 45,802,716 M656V probably damaging Het
Pif1 T C 9: 65,593,576 W559R probably damaging Het
Pllp T C 8: 94,679,394 Y87C probably damaging Het
Ppp1r3a T C 6: 14,719,047 N623D probably benign Het
Prkcg C T 7: 3,318,953 R345C probably damaging Het
Rgl1 T C 1: 152,557,574 I147V probably benign Het
Sdk1 T A 5: 142,146,263 L1649Q probably damaging Het
Sema3b C T 9: 107,602,067 probably null Het
Sh3rf3 G A 10: 59,083,519 R486H probably damaging Het
Slain2 A G 5: 72,948,598 N192S probably benign Het
Slc22a16 T A 10: 40,574,051 I161N probably damaging Het
Strip1 T C 3: 107,616,916 K562E possibly damaging Het
Sumf1 A G 6: 108,185,495 L21S probably benign Het
Sytl3 T A 17: 6,737,765 S380T probably damaging Het
Tgfb1i1 T A 7: 128,248,668 C74* probably null Het
Tmprss15 T G 16: 78,960,591 I939L probably benign Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Vwde A T 6: 13,215,640 V139E probably damaging Het
Wdr27 A G 17: 14,917,213 probably null Het
Zkscan14 A G 5: 145,195,191 V510A probably benign Het
Other mutations in Gas2l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Gas2l3 APN 10 89413627 missense probably benign 0.00
IGL01148:Gas2l3 APN 10 89413504 missense probably benign 0.25
R0472:Gas2l3 UTSW 10 89426477 missense probably damaging 1.00
R0578:Gas2l3 UTSW 10 89417075 missense probably damaging 1.00
R0720:Gas2l3 UTSW 10 89413943 missense probably benign 0.00
R1386:Gas2l3 UTSW 10 89414353 missense possibly damaging 0.77
R1470:Gas2l3 UTSW 10 89413934 missense probably benign
R1470:Gas2l3 UTSW 10 89413934 missense probably benign
R1530:Gas2l3 UTSW 10 89433769 missense probably benign 0.02
R1733:Gas2l3 UTSW 10 89414265 missense probably damaging 1.00
R1772:Gas2l3 UTSW 10 89417014 unclassified probably benign
R1840:Gas2l3 UTSW 10 89422251 missense possibly damaging 0.79
R2168:Gas2l3 UTSW 10 89414098 missense probably benign 0.01
R3082:Gas2l3 UTSW 10 89430958 small deletion probably benign
R3083:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4639:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4641:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4642:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4643:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4644:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4645:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4809:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4810:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4820:Gas2l3 UTSW 10 89417045 missense probably damaging 1.00
R4852:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4855:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4865:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4900:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4906:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4926:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4946:Gas2l3 UTSW 10 89413772 missense probably benign
R5072:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5073:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5074:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5137:Gas2l3 UTSW 10 89413975 missense probably damaging 1.00
R5579:Gas2l3 UTSW 10 89414066 missense probably benign
R5919:Gas2l3 UTSW 10 89417055 missense probably damaging 1.00
R6573:Gas2l3 UTSW 10 89422210 splice site probably null
R6763:Gas2l3 UTSW 10 89413369 missense probably benign 0.00
R6961:Gas2l3 UTSW 10 89413291 missense probably benign 0.00
R7491:Gas2l3 UTSW 10 89413901 missense probably benign 0.02
R7707:Gas2l3 UTSW 10 89414358 missense probably damaging 1.00
R7806:Gas2l3 UTSW 10 89413370 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCTGACTCTGACATTCACTG -3'
(R):5'- GACATCAACCACTGTATTCAATGC -3'

Sequencing Primer
(F):5'- ACTGAGTATCCCTGGCATCTGG -3'
(R):5'- ACAATTTTGCTTATTCTGGATGGTC -3'
Posted On2016-03-01