Incidental Mutation 'R4853:Tmprss15'
ID373744
Institutional Source Beutler Lab
Gene Symbol Tmprss15
Ensembl Gene ENSMUSG00000022857
Gene Nametransmembrane protease, serine 15
SynonymsA130097D21Rik, enterokinase, enteropeptidase, Prss7
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4853 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location78953008-79091097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 78960591 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 939 (I939L)
Ref Sequence ENSEMBL: ENSMUSP00000052034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023566] [ENSMUST00000060402]
Predicted Effect probably benign
Transcript: ENSMUST00000023566
AA Change: I954L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023566
Gene: ENSMUSG00000022857
AA Change: I954L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 228 268 1.74e-4 SMART
CUB 270 379 1.54e-11 SMART
MAM 387 549 7.33e-54 SMART
low complexity region 551 567 N/A INTRINSIC
CUB 569 679 1.72e-32 SMART
LDLa 687 724 7.32e-12 SMART
SR 723 813 3.12e-5 SMART
Tryp_SPc 829 1064 1.48e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060402
AA Change: I939L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052034
Gene: ENSMUSG00000022857
AA Change: I939L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 213 253 1.74e-4 SMART
CUB 255 364 1.54e-11 SMART
MAM 372 534 7.33e-54 SMART
low complexity region 536 552 N/A INTRINSIC
CUB 554 664 1.72e-32 SMART
LDLa 672 709 7.32e-12 SMART
SR 708 798 3.12e-5 SMART
Tryp_SPc 814 1049 1.48e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152173
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that proteolytically activates the pancreatic proenzyme trypsinogen, converting it into trypsin. The encoded protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Abr T C 11: 76,464,261 T244A probably damaging Het
Adcy10 T A 1: 165,548,213 N803K probably benign Het
Afm T C 5: 90,551,467 F590S probably damaging Het
Agk T C 6: 40,383,819 probably null Het
Agrn C T 4: 156,185,550 probably null Het
AI481877 T C 4: 59,072,345 K624E possibly damaging Het
Apon A G 10: 128,255,082 S210G probably benign Het
Atad5 A G 11: 80,095,272 E395G probably damaging Het
AU018091 A T 7: 3,156,021 L671H probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Ccdc154 A T 17: 25,170,967 I524F probably damaging Het
Clspn T A 4: 126,566,555 I525K probably damaging Het
Cpne5 A T 17: 29,161,198 V448E probably benign Het
Cps1 A G 1: 67,156,202 I261V possibly damaging Het
Crybb2 T C 5: 113,063,188 E78G probably damaging Het
Ctps G T 4: 120,554,010 L270I probably damaging Het
Cyp19a1 T C 9: 54,166,776 D431G probably benign Het
Cyp3a57 T G 5: 145,365,679 V95G probably damaging Het
Ddx54 A G 5: 120,623,629 D490G probably benign Het
Dnaic2 A T 11: 114,745,091 I301F probably benign Het
Dsg1b A G 18: 20,408,736 S767G probably benign Het
Dsg1b A T 18: 20,390,132 probably null Het
Ermap G A 4: 119,187,254 P115L probably damaging Het
Esrra T G 19: 6,920,072 T106P probably damaging Het
Exoc5 GTATT GT 14: 49,052,369 probably benign Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gnl3 T C 14: 31,015,313 K203E probably damaging Het
Habp2 G A 19: 56,311,191 probably null Het
Hist1h2ai A G 13: 21,716,696 E92G probably damaging Het
Kcnh3 A C 15: 99,242,089 D952A possibly damaging Het
Kif27 T C 13: 58,311,258 K920E probably benign Het
Kmt2e C T 5: 23,502,341 P1634L probably damaging Het
Lamc1 A T 1: 153,229,100 M1312K possibly damaging Het
Myh14 T A 7: 44,608,448 Q1921L probably damaging Het
Ncor2 A G 5: 125,025,105 V68A probably damaging Het
Ncor2 A G 5: 125,081,183 F444L unknown Het
Nedd9 A G 13: 41,316,361 Y439H probably benign Het
Nsd1 T A 13: 55,268,504 H1454Q probably benign Het
Olfr1160 A G 2: 88,006,104 S216P probably damaging Het
Olfr1418 T A 19: 11,855,281 D224V probably benign Het
Olfr152 T G 2: 87,783,182 F214C probably benign Het
Olfr624 G T 7: 103,670,803 T76K probably damaging Het
P4ha2 G A 11: 54,120,170 S337N probably benign Het
Pck1 T A 2: 173,154,714 Y140* probably null Het
Phldb2 T C 16: 45,802,716 M656V probably damaging Het
Pif1 T C 9: 65,593,576 W559R probably damaging Het
Pllp T C 8: 94,679,394 Y87C probably damaging Het
Ppp1r3a T C 6: 14,719,047 N623D probably benign Het
Prkcg C T 7: 3,318,953 R345C probably damaging Het
Rgl1 T C 1: 152,557,574 I147V probably benign Het
Sdk1 T A 5: 142,146,263 L1649Q probably damaging Het
Sema3b C T 9: 107,602,067 probably null Het
Sh3rf3 G A 10: 59,083,519 R486H probably damaging Het
Slain2 A G 5: 72,948,598 N192S probably benign Het
Slc22a16 T A 10: 40,574,051 I161N probably damaging Het
Strip1 T C 3: 107,616,916 K562E possibly damaging Het
Sumf1 A G 6: 108,185,495 L21S probably benign Het
Sytl3 T A 17: 6,737,765 S380T probably damaging Het
Tgfb1i1 T A 7: 128,248,668 C74* probably null Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Vwde A T 6: 13,215,640 V139E probably damaging Het
Wdr27 A G 17: 14,917,213 probably null Het
Zkscan14 A G 5: 145,195,191 V510A probably benign Het
Other mutations in Tmprss15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmprss15 APN 16 78985994 missense possibly damaging 0.87
IGL00477:Tmprss15 APN 16 79021413 missense probably damaging 1.00
IGL01583:Tmprss15 APN 16 79071261 missense probably benign
IGL01896:Tmprss15 APN 16 79090790 missense probably benign 0.22
IGL02052:Tmprss15 APN 16 79087506 missense probably damaging 1.00
IGL02374:Tmprss15 APN 16 79035168 missense probably benign 0.00
IGL02505:Tmprss15 APN 16 78987741 missense probably benign 0.00
IGL02632:Tmprss15 APN 16 78985902 missense probably damaging 0.98
IGL02674:Tmprss15 APN 16 79001794 missense possibly damaging 0.72
PIT1430001:Tmprss15 UTSW 16 79024752 critical splice donor site probably null
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0195:Tmprss15 UTSW 16 79034334 missense probably benign 0.05
R0335:Tmprss15 UTSW 16 79024742 splice site probably benign
R0514:Tmprss15 UTSW 16 78968267 missense probably benign 0.05
R0552:Tmprss15 UTSW 16 79024749 splice site probably null
R0675:Tmprss15 UTSW 16 78985950 missense probably damaging 0.98
R0739:Tmprss15 UTSW 16 79024848 missense possibly damaging 0.62
R1435:Tmprss15 UTSW 16 79021454 missense probably benign 0.03
R1446:Tmprss15 UTSW 16 79078958 missense probably benign 0.01
R1572:Tmprss15 UTSW 16 79090829 missense probably benign 0.00
R1708:Tmprss15 UTSW 16 79054070 missense possibly damaging 0.95
R1893:Tmprss15 UTSW 16 79071418 missense probably benign
R2403:Tmprss15 UTSW 16 79057690 missense probably damaging 1.00
R2866:Tmprss15 UTSW 16 79035233 missense possibly damaging 0.65
R2913:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R2914:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R3425:Tmprss15 UTSW 16 79003433 missense possibly damaging 0.83
R3703:Tmprss15 UTSW 16 79054142 critical splice acceptor site probably null
R3916:Tmprss15 UTSW 16 78985996 missense probably damaging 1.00
R3950:Tmprss15 UTSW 16 79073186 missense probably benign 0.04
R4332:Tmprss15 UTSW 16 79034334 missense probably benign 0.15
R4392:Tmprss15 UTSW 16 79024438 missense probably damaging 1.00
R4515:Tmprss15 UTSW 16 78957356 missense probably benign 0.00
R4619:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4620:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4754:Tmprss15 UTSW 16 79054124 missense probably damaging 0.98
R5159:Tmprss15 UTSW 16 79003410 missense probably benign 0.26
R5441:Tmprss15 UTSW 16 79071447 critical splice acceptor site probably null
R5824:Tmprss15 UTSW 16 79034313 missense probably damaging 0.99
R5970:Tmprss15 UTSW 16 79057659 missense probably benign 0.00
R6224:Tmprss15 UTSW 16 79024378 missense probably benign 0.08
R6257:Tmprss15 UTSW 16 78972225 missense probably damaging 1.00
R6313:Tmprss15 UTSW 16 78962170 missense probably benign 0.16
R6368:Tmprss15 UTSW 16 79006057 intron probably null
R6525:Tmprss15 UTSW 16 79003378 missense probably damaging 0.97
R6587:Tmprss15 UTSW 16 79071429 missense probably benign
R6894:Tmprss15 UTSW 16 79075814 nonsense probably null
R7018:Tmprss15 UTSW 16 79024853 missense possibly damaging 0.78
R7180:Tmprss15 UTSW 16 78967998 missense probably damaging 0.97
R7324:Tmprss15 UTSW 16 78962019 missense probably damaging 1.00
R7337:Tmprss15 UTSW 16 79071276 missense probably benign 0.01
R7558:Tmprss15 UTSW 16 79003414 missense possibly damaging 0.55
R7732:Tmprss15 UTSW 16 79003420 missense probably benign 0.11
R7792:Tmprss15 UTSW 16 79003387 missense probably damaging 1.00
R7829:Tmprss15 UTSW 16 78987650 missense probably benign 0.02
R7998:Tmprss15 UTSW 16 79001843 missense possibly damaging 0.79
R8009:Tmprss15 UTSW 16 79090863 missense probably damaging 0.96
R8145:Tmprss15 UTSW 16 78960585 missense probably damaging 1.00
RF005:Tmprss15 UTSW 16 78953801 makesense probably null
Predicted Primers PCR Primer
(F):5'- AACTCTGTTCAAGATGTAGTCCTG -3'
(R):5'- ATCTGAAGGAGTTCCAGCATAATG -3'

Sequencing Primer
(F):5'- CTGTTCAAGATGTAGTCCTGAAAGG -3'
(R):5'- TGAAGGAGTTCCAGCATAATGAAATC -3'
Posted On2016-03-01