Incidental Mutation 'R4854:Zfp462'
ID373771
Institutional Source Beutler Lab
Gene Symbol Zfp462
Ensembl Gene ENSMUSG00000060206
Gene Namezinc finger protein 462
SynonymsZfpip, 9430078C22Rik, Gt4-2
MMRRC Submission 042465-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.536) question?
Stock #R4854 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location54945048-55083563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55010668 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 878 (Y878C)
Ref Sequence ENSEMBL: ENSMUSP00000095677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030131] [ENSMUST00000079605] [ENSMUST00000098070] [ENSMUST00000133895]
AlphaFold B1AWL2
Predicted Effect probably benign
Transcript: ENSMUST00000030131
SMART Domains Protein: ENSMUSP00000030131
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 892 914 3.11e-2 SMART
ZnF_C2H2 926 948 4.11e-2 SMART
ZnF_C2H2 955 978 4.98e-1 SMART
ZnF_C2H2 984 1007 5.5e-3 SMART
ZnF_C2H2 1092 1115 7.05e-1 SMART
ZnF_C2H2 1121 1144 5.48e0 SMART
ZnF_C2H2 1155 1177 6.13e-1 SMART
ZnF_C2H2 1201 1223 1.26e-2 SMART
ZnF_C2H2 1229 1252 2.02e-1 SMART
low complexity region 1273 1296 N/A INTRINSIC
ZnF_C2H2 1315 1337 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079605
SMART Domains Protein: ENSMUSP00000078555
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 893 915 3.11e-2 SMART
ZnF_C2H2 927 949 4.11e-2 SMART
ZnF_C2H2 956 979 4.98e-1 SMART
ZnF_C2H2 985 1008 5.5e-3 SMART
ZnF_C2H2 1093 1116 7.05e-1 SMART
ZnF_C2H2 1122 1145 5.48e0 SMART
ZnF_C2H2 1156 1178 6.13e-1 SMART
ZnF_C2H2 1202 1224 1.26e-2 SMART
ZnF_C2H2 1230 1253 2.02e-1 SMART
low complexity region 1274 1297 N/A INTRINSIC
ZnF_C2H2 1316 1338 2.2e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098070
AA Change: Y878C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095677
Gene: ENSMUSG00000060206
AA Change: Y878C

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 94 N/A INTRINSIC
ZnF_C2H2 108 131 1.79e-2 SMART
ZnF_C2H2 162 185 4.65e-1 SMART
low complexity region 194 215 N/A INTRINSIC
ZnF_C2H2 243 266 4.98e-1 SMART
low complexity region 332 343 N/A INTRINSIC
ZnF_C2H2 440 463 1.01e-1 SMART
ZnF_C2H2 471 493 2.86e-1 SMART
low complexity region 503 515 N/A INTRINSIC
low complexity region 536 592 N/A INTRINSIC
ZnF_C2H2 593 616 2.53e-2 SMART
low complexity region 707 736 N/A INTRINSIC
ZnF_C2H2 835 858 5.62e0 SMART
ZnF_C2H2 878 900 2.14e0 SMART
ZnF_C2H2 917 940 6.67e-2 SMART
ZnF_C2H2 1023 1046 5.72e-1 SMART
low complexity region 1092 1100 N/A INTRINSIC
ZnF_C2H2 1107 1130 4.23e0 SMART
ZnF_C2H2 1183 1206 4.81e0 SMART
ZnF_C2H2 1254 1277 6.67e-2 SMART
ZnF_C2H2 1301 1324 3.47e0 SMART
ZnF_C2H2 1358 1381 7.29e0 SMART
ZnF_C2H2 1459 1482 2.17e-1 SMART
ZnF_C2H2 1504 1527 6.57e0 SMART
ZnF_C2H2 1566 1589 5.34e-1 SMART
low complexity region 1598 1611 N/A INTRINSIC
ZnF_C2H2 1649 1672 8.22e-2 SMART
ZnF_C2H2 1686 1709 5.34e0 SMART
ZnF_C2H2 1756 1779 6.4e0 SMART
low complexity region 1803 1824 N/A INTRINSIC
ZnF_C2H2 1835 1859 3.05e1 SMART
ZnF_C2H2 1881 1903 1.08e-1 SMART
low complexity region 1905 1919 N/A INTRINSIC
ZnF_C2H2 1957 1979 1.51e0 SMART
ZnF_C2H2 2014 2036 4.11e-2 SMART
ZnF_C2H2 2043 2066 4.98e-1 SMART
ZnF_C2H2 2072 2095 5.5e-3 SMART
ZnF_C2H2 2180 2203 7.05e-1 SMART
ZnF_C2H2 2209 2232 5.48e0 SMART
ZnF_C2H2 2243 2265 6.13e-1 SMART
ZnF_C2H2 2289 2311 1.26e-2 SMART
ZnF_C2H2 2317 2340 2.02e-1 SMART
low complexity region 2361 2384 N/A INTRINSIC
ZnF_C2H2 2403 2425 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133895
SMART Domains Protein: ENSMUSP00000122775
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 93 N/A INTRINSIC
Meta Mutation Damage Score 0.4186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to C2H2-type zinc finger family of proteins. It contains multiple C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik T A 9: 22,208,037 noncoding transcript Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Abl1 T C 2: 31,779,010 Y110H probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Agbl3 G A 6: 34,785,284 R73Q probably damaging Het
Agl C T 3: 116,778,618 probably null Het
Amotl1 G A 9: 14,593,451 Q191* probably null Het
Apbb1ip A G 2: 22,853,202 K349E possibly damaging Het
Arhgap10 G A 8: 77,420,089 Q229* probably null Het
Aspm C T 1: 139,478,072 Q1566* probably null Het
B3gnt3 G A 8: 71,692,873 R284C probably damaging Het
Brd4 A G 17: 32,220,237 V423A probably damaging Het
Btbd9 A T 17: 30,524,865 I221N probably damaging Het
Camp A G 9: 109,847,451 V168A probably benign Het
Cd1d2 T A 3: 86,989,249 probably null Het
Cdkn2d A T 9: 21,290,927 V8D probably benign Het
Clec4g T C 8: 3,716,534 N256D probably damaging Het
Clspn A G 4: 126,575,950 I771V probably benign Het
Cntn6 A G 6: 104,859,475 E862G possibly damaging Het
Col6a5 T C 9: 105,898,751 T1702A probably benign Het
Dnah7a T C 1: 53,706,729 probably benign Het
Dubr T C 16: 50,732,523 noncoding transcript Het
Dusp26 G A 8: 31,094,137 V91M probably damaging Het
Edc4 A T 8: 105,887,925 probably benign Het
F5 C T 1: 164,192,146 A730V probably damaging Het
Foxf1 A G 8: 121,086,814 T358A probably benign Het
Frem1 A T 4: 82,916,758 N1810K possibly damaging Het
Galc A T 12: 98,256,877 F87I probably damaging Het
Gars A G 6: 55,046,418 D66G probably damaging Het
Gbp11 G A 5: 105,325,508 L460F probably damaging Het
Gdf7 T C 12: 8,298,014 I436V probably damaging Het
Gigyf2 C T 1: 87,354,413 probably benign Het
Gm12239 T C 11: 56,015,953 noncoding transcript Het
Gm5592 A C 7: 41,217,471 probably benign Het
Gp2 A T 7: 119,452,199 D264E possibly damaging Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Grid1 A G 14: 35,321,641 I318V probably benign Het
Grm2 C A 9: 106,654,132 V53F possibly damaging Het
Gtpbp1 T C 15: 79,719,205 S632P probably benign Het
H2-M1 A G 17: 36,670,058 F329L probably benign Het
Hecw1 T A 13: 14,316,892 D92V probably benign Het
Hgh1 T C 15: 76,369,182 L76P probably damaging Het
Idi2 C A 13: 8,957,843 N63K probably benign Het
Ift122 A G 6: 115,862,746 T25A possibly damaging Het
Itgb2l A T 16: 96,426,117 C575* probably null Het
Jup A G 11: 100,383,041 S225P possibly damaging Het
Kcng3 A T 17: 83,588,306 C244S probably damaging Het
Klhl2 T A 8: 64,834,459 M46L possibly damaging Het
Ksr1 A T 11: 79,027,702 I460N probably damaging Het
Lama3 T A 18: 12,411,542 F314Y probably benign Het
Lbp T C 2: 158,327,518 V421A possibly damaging Het
Lcp1 G A 14: 75,200,489 G113D probably damaging Het
Lrp1b A T 2: 41,111,077 L2045H probably damaging Het
Mbd2 G T 18: 70,568,735 D107Y unknown Het
Ms4a14 C T 19: 11,310,369 V96I possibly damaging Het
N4bp2l2 C T 5: 150,662,051 E155K probably benign Het
Nbeal2 T G 9: 110,631,396 H1790P probably damaging Het
Nsg2 G A 11: 32,031,806 G84R probably benign Het
Odf3 A G 7: 140,849,462 Y168C probably damaging Het
Olfr1145 A G 2: 87,810,590 T257A probably damaging Het
Olfr286 A C 15: 98,227,544 F34V possibly damaging Het
P2rx2 T C 5: 110,340,927 N224D probably damaging Het
P2rx5 A T 11: 73,171,779 E438V probably benign Het
Paip1 C A 13: 119,449,889 probably benign Het
Pik3c2g T A 6: 139,768,779 V219E probably damaging Het
Ppp1r12b T C 1: 134,873,951 E509G probably damaging Het
Ppp1r15a T C 7: 45,525,373 S4G probably benign Het
Ppp5c T C 7: 17,009,022 S224G probably benign Het
Prr30 T G 14: 101,198,443 I228L probably benign Het
Purg A G 8: 33,387,314 I327V possibly damaging Het
Ralb T C 1: 119,475,915 T161A probably benign Het
Ripor3 T C 2: 167,992,813 R253G probably benign Het
Scgb2b6 T C 7: 31,617,832 noncoding transcript Het
Setd5 G T 6: 113,151,399 G1438W probably damaging Het
Sh3rf3 T A 10: 58,813,723 L50Q possibly damaging Het
Sipa1l2 G T 8: 125,473,601 T662K probably damaging Het
Skint5 A G 4: 113,580,528 L1021S unknown Het
Slc22a23 T C 13: 34,203,941 S391G probably benign Het
Slc4a5 G A 6: 83,271,017 V402I probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Spink5 A T 18: 44,020,841 *1018C probably null Het
Stag3 T A 5: 138,296,694 probably null Het
Tmem117 T C 15: 95,094,688 F410L probably damaging Het
Tmod1 A G 4: 46,090,920 K158E possibly damaging Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Traf4 G A 11: 78,161,520 Q100* probably null Het
Trpc4 A G 3: 54,302,218 Y668C probably damaging Het
Ttn T A 2: 76,767,583 N11335I possibly damaging Het
Uhrf1bp1l T G 10: 89,794,484 V382G probably damaging Het
Usp39 A T 6: 72,325,682 V463E probably benign Het
Vmn1r6 A C 6: 57,002,698 Y115S probably benign Het
Vmn2r44 A G 7: 8,380,301 I98T possibly damaging Het
Zfp474 T C 18: 52,638,431 I52T possibly damaging Het
Other mutations in Zfp462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfp462 APN 4 55011483 splice site probably null
IGL00421:Zfp462 APN 4 55023576 missense probably benign 0.00
IGL00899:Zfp462 APN 4 55007732 missense probably damaging 1.00
IGL01549:Zfp462 APN 4 55013181 missense probably damaging 1.00
IGL01627:Zfp462 APN 4 55008912 missense possibly damaging 0.93
IGL01715:Zfp462 APN 4 55008586 missense probably benign 0.20
IGL01862:Zfp462 APN 4 55023441 missense probably damaging 1.00
IGL01878:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL01913:Zfp462 APN 4 55012138 missense probably benign 0.04
IGL02029:Zfp462 APN 4 55079395 splice site probably benign
IGL02338:Zfp462 APN 4 55010292 missense possibly damaging 0.88
IGL02552:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL02623:Zfp462 APN 4 55012986 missense probably damaging 1.00
IGL02750:Zfp462 APN 4 55060236 missense probably null 1.00
IGL02815:Zfp462 APN 4 55051303 missense probably damaging 1.00
IGL03204:Zfp462 APN 4 55080785 missense possibly damaging 0.80
FR4304:Zfp462 UTSW 4 55009757 unclassified probably benign
FR4304:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009761 unclassified probably benign
P0035:Zfp462 UTSW 4 55009086 missense probably benign
R0052:Zfp462 UTSW 4 55011762 missense probably benign 0.03
R0143:Zfp462 UTSW 4 55023402 splice site probably benign
R0145:Zfp462 UTSW 4 55010529 missense probably damaging 1.00
R0315:Zfp462 UTSW 4 55079314 missense probably damaging 0.99
R0349:Zfp462 UTSW 4 55008768 missense probably benign
R0359:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0413:Zfp462 UTSW 4 55010534 missense probably damaging 0.99
R0554:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0616:Zfp462 UTSW 4 55011951 missense probably damaging 1.00
R0631:Zfp462 UTSW 4 55007563 start codon destroyed possibly damaging 0.60
R1086:Zfp462 UTSW 4 55013000 missense probably damaging 1.00
R1499:Zfp462 UTSW 4 55060046 missense probably damaging 1.00
R1509:Zfp462 UTSW 4 55007667 missense probably damaging 1.00
R1526:Zfp462 UTSW 4 55009002 missense probably benign
R1541:Zfp462 UTSW 4 55008928 missense possibly damaging 0.53
R1691:Zfp462 UTSW 4 55013489 missense possibly damaging 0.70
R1843:Zfp462 UTSW 4 55010010 missense possibly damaging 0.88
R2086:Zfp462 UTSW 4 55010830 missense probably damaging 1.00
R2109:Zfp462 UTSW 4 55008496 missense probably benign 0.00
R2148:Zfp462 UTSW 4 55013670 missense probably benign 0.01
R2179:Zfp462 UTSW 4 55009524 missense possibly damaging 0.73
R2325:Zfp462 UTSW 4 55013712 missense probably benign
R2352:Zfp462 UTSW 4 55008313 missense probably null
R2566:Zfp462 UTSW 4 55008522 missense probably benign 0.00
R3879:Zfp462 UTSW 4 55060095 missense probably damaging 1.00
R3969:Zfp462 UTSW 4 55012402 missense probably damaging 1.00
R4273:Zfp462 UTSW 4 55008411 missense probably benign 0.00
R4413:Zfp462 UTSW 4 55012672 missense probably damaging 0.99
R4510:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4511:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4609:Zfp462 UTSW 4 55011889 missense probably damaging 1.00
R4632:Zfp462 UTSW 4 55012981 missense probably damaging 1.00
R4649:Zfp462 UTSW 4 55009349 missense probably benign
R4682:Zfp462 UTSW 4 55011376 missense probably damaging 1.00
R4696:Zfp462 UTSW 4 55008612 missense probably benign
R4744:Zfp462 UTSW 4 55011598 missense probably damaging 1.00
R4747:Zfp462 UTSW 4 55013476 missense probably benign 0.00
R4819:Zfp462 UTSW 4 55060044 missense probably damaging 1.00
R4827:Zfp462 UTSW 4 55012213 missense probably damaging 1.00
R4879:Zfp462 UTSW 4 55009444 missense probably benign 0.02
R4891:Zfp462 UTSW 4 55060055 missense probably damaging 1.00
R4993:Zfp462 UTSW 4 55051204 missense possibly damaging 0.62
R5118:Zfp462 UTSW 4 55010667 missense probably damaging 1.00
R5171:Zfp462 UTSW 4 55016986 splice site probably null
R5173:Zfp462 UTSW 4 55011115 missense probably damaging 0.99
R5221:Zfp462 UTSW 4 55016887 missense possibly damaging 0.86
R5268:Zfp462 UTSW 4 55012299 missense probably benign
R5314:Zfp462 UTSW 4 55013178 missense probably damaging 1.00
R5429:Zfp462 UTSW 4 55060077 missense probably damaging 1.00
R5518:Zfp462 UTSW 4 55009818 missense probably damaging 0.99
R5525:Zfp462 UTSW 4 55050281 missense possibly damaging 0.73
R5620:Zfp462 UTSW 4 55013464 missense probably benign 0.01
R5775:Zfp462 UTSW 4 55010590 missense probably damaging 0.99
R6126:Zfp462 UTSW 4 55023573 missense probably benign 0.01
R6280:Zfp462 UTSW 4 55010253 missense probably benign 0.00
R6325:Zfp462 UTSW 4 55080680 missense probably benign 0.04
R6542:Zfp462 UTSW 4 55023433 missense probably damaging 1.00
R6612:Zfp462 UTSW 4 55012324 splice site probably null
R6663:Zfp462 UTSW 4 55008933 missense possibly damaging 0.53
R6872:Zfp462 UTSW 4 55012326 missense probably benign 0.01
R6889:Zfp462 UTSW 4 55007671 missense probably damaging 1.00
R6896:Zfp462 UTSW 4 55009544 missense possibly damaging 0.72
R6913:Zfp462 UTSW 4 55007775 missense probably benign 0.25
R6988:Zfp462 UTSW 4 55080716 missense probably benign 0.00
R7131:Zfp462 UTSW 4 55009380 missense probably benign
R7151:Zfp462 UTSW 4 55051271 missense probably damaging 0.99
R7684:Zfp462 UTSW 4 55008908 missense probably benign
R7741:Zfp462 UTSW 4 55008637 missense probably benign 0.00
R7750:Zfp462 UTSW 4 55016958 missense probably benign 0.06
R7812:Zfp462 UTSW 4 55008509 missense probably benign 0.00
R7863:Zfp462 UTSW 4 55007747 missense probably benign
R7898:Zfp462 UTSW 4 55012995 missense probably damaging 0.98
R7993:Zfp462 UTSW 4 55011907 missense probably damaging 1.00
R7995:Zfp462 UTSW 4 55011907 missense probably damaging 1.00
R8023:Zfp462 UTSW 4 55073106 critical splice donor site probably null
R8394:Zfp462 UTSW 4 55011862 missense probably damaging 1.00
R8669:Zfp462 UTSW 4 55051313 missense probably damaging 0.99
R8877:Zfp462 UTSW 4 55011097 missense probably damaging 0.98
R8980:Zfp462 UTSW 4 55009681 unclassified probably benign
R9023:Zfp462 UTSW 4 55007563 start codon destroyed probably null 0.00
Predicted Primers PCR Primer
(F):5'- GATCAAGTGTCCAATGCGGC -3'
(R):5'- AATGCGGCATCAGGCTTCTG -3'

Sequencing Primer
(F):5'- AATGCGGCTCTGCTGAACAC -3'
(R):5'- TCTGACATTCGGGCTAGTGTAAGAAC -3'
Posted On2016-03-01