Incidental Mutation 'R4854:Gbp11'
ID373776
Institutional Source Beutler Lab
Gene Symbol Gbp11
Ensembl Gene ENSMUSG00000092021
Gene Nameguanylate binding protein 11
SynonymsGm7141
MMRRC Submission 042465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4854 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location105323042-105346472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105325508 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 460 (L460F)
Ref Sequence ENSEMBL: ENSMUSP00000098520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100960] [ENSMUST00000171587]
AlphaFold A9YVJ5
Predicted Effect probably damaging
Transcript: ENSMUST00000100960
AA Change: L460F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098520
Gene: ENSMUSG00000092021
AA Change: L460F

DomainStartEndE-ValueType
Pfam:GBP 16 279 1.5e-122 PFAM
Pfam:GBP_C 281 574 3.4e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171587
SMART Domains Protein: ENSMUSP00000132552
Gene: ENSMUSG00000092021

DomainStartEndE-ValueType
Pfam:GBP 16 279 4.9e-117 PFAM
Pfam:GBP_C 281 442 2.7e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194188
AA Change: L460F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141837
Gene: ENSMUSG00000103344
AA Change: L460F

DomainStartEndE-ValueType
Pfam:GBP 16 279 3.1e-120 PFAM
Pfam:GBP_C 281 575 8.4e-114 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (103/105)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik T A 9: 22,208,037 noncoding transcript Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abl1 T C 2: 31,779,010 Y110H probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Agbl3 G A 6: 34,785,284 R73Q probably damaging Het
Agl C T 3: 116,778,618 probably null Het
Amotl1 G A 9: 14,593,451 Q191* probably null Het
Apbb1ip A G 2: 22,853,202 K349E possibly damaging Het
Arhgap10 G A 8: 77,420,089 Q229* probably null Het
Aspm C T 1: 139,478,072 Q1566* probably null Het
B3gnt3 G A 8: 71,692,873 R284C probably damaging Het
Brd4 A G 17: 32,220,237 V423A probably damaging Het
Btbd9 A T 17: 30,524,865 I221N probably damaging Het
Camp A G 9: 109,847,451 V168A probably benign Het
Cd1d2 T A 3: 86,989,249 probably null Het
Cdkn2d A T 9: 21,290,927 V8D probably benign Het
Clec4g T C 8: 3,716,534 N256D probably damaging Het
Clspn A G 4: 126,575,950 I771V probably benign Het
Cntn6 A G 6: 104,859,475 E862G possibly damaging Het
Col6a5 T C 9: 105,898,751 T1702A probably benign Het
Dnah7a T C 1: 53,706,729 probably benign Het
Dubr T C 16: 50,732,523 noncoding transcript Het
Dusp26 G A 8: 31,094,137 V91M probably damaging Het
Edc4 A T 8: 105,887,925 probably benign Het
F5 C T 1: 164,192,146 A730V probably damaging Het
Foxf1 A G 8: 121,086,814 T358A probably benign Het
Frem1 A T 4: 82,916,758 N1810K possibly damaging Het
Galc A T 12: 98,256,877 F87I probably damaging Het
Gars A G 6: 55,046,418 D66G probably damaging Het
Gdf7 T C 12: 8,298,014 I436V probably damaging Het
Gigyf2 C T 1: 87,354,413 probably benign Het
Gm12239 T C 11: 56,015,953 noncoding transcript Het
Gm5592 A C 7: 41,217,471 probably benign Het
Gp2 A T 7: 119,452,199 D264E possibly damaging Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Grid1 A G 14: 35,321,641 I318V probably benign Het
Grm2 C A 9: 106,654,132 V53F possibly damaging Het
Gtpbp1 T C 15: 79,719,205 S632P probably benign Het
H2-M1 A G 17: 36,670,058 F329L probably benign Het
Hecw1 T A 13: 14,316,892 D92V probably benign Het
Hgh1 T C 15: 76,369,182 L76P probably damaging Het
Idi2 C A 13: 8,957,843 N63K probably benign Het
Ift122 A G 6: 115,862,746 T25A possibly damaging Het
Itgb2l A T 16: 96,426,117 C575* probably null Het
Jup A G 11: 100,383,041 S225P possibly damaging Het
Kcng3 A T 17: 83,588,306 C244S probably damaging Het
Klhl2 T A 8: 64,834,459 M46L possibly damaging Het
Ksr1 A T 11: 79,027,702 I460N probably damaging Het
Lama3 T A 18: 12,411,542 F314Y probably benign Het
Lbp T C 2: 158,327,518 V421A possibly damaging Het
Lcp1 G A 14: 75,200,489 G113D probably damaging Het
Lrp1b A T 2: 41,111,077 L2045H probably damaging Het
Mbd2 G T 18: 70,568,735 D107Y unknown Het
Ms4a14 C T 19: 11,310,369 V96I possibly damaging Het
N4bp2l2 C T 5: 150,662,051 E155K probably benign Het
Nbeal2 T G 9: 110,631,396 H1790P probably damaging Het
Nsg2 G A 11: 32,031,806 G84R probably benign Het
Odf3 A G 7: 140,849,462 Y168C probably damaging Het
Olfr1145 A G 2: 87,810,590 T257A probably damaging Het
Olfr286 A C 15: 98,227,544 F34V possibly damaging Het
P2rx2 T C 5: 110,340,927 N224D probably damaging Het
P2rx5 A T 11: 73,171,779 E438V probably benign Het
Paip1 C A 13: 119,449,889 probably benign Het
Pik3c2g T A 6: 139,768,779 V219E probably damaging Het
Ppp1r12b T C 1: 134,873,951 E509G probably damaging Het
Ppp1r15a T C 7: 45,525,373 S4G probably benign Het
Ppp5c T C 7: 17,009,022 S224G probably benign Het
Prr30 T G 14: 101,198,443 I228L probably benign Het
Purg A G 8: 33,387,314 I327V possibly damaging Het
Ralb T C 1: 119,475,915 T161A probably benign Het
Ripor3 T C 2: 167,992,813 R253G probably benign Het
Scgb2b6 T C 7: 31,617,832 noncoding transcript Het
Setd5 G T 6: 113,151,399 G1438W probably damaging Het
Sh3rf3 T A 10: 58,813,723 L50Q possibly damaging Het
Sipa1l2 G T 8: 125,473,601 T662K probably damaging Het
Skint5 A G 4: 113,580,528 L1021S unknown Het
Slc22a23 T C 13: 34,203,941 S391G probably benign Het
Slc4a5 G A 6: 83,271,017 V402I probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Spink5 A T 18: 44,020,841 *1018C probably null Het
Stag3 T A 5: 138,296,694 probably null Het
Tmem117 T C 15: 95,094,688 F410L probably damaging Het
Tmod1 A G 4: 46,090,920 K158E possibly damaging Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Traf4 G A 11: 78,161,520 Q100* probably null Het
Trpc4 A G 3: 54,302,218 Y668C probably damaging Het
Ttn T A 2: 76,767,583 N11335I possibly damaging Het
Uhrf1bp1l T G 10: 89,794,484 V382G probably damaging Het
Usp39 A T 6: 72,325,682 V463E probably benign Het
Vmn1r6 A C 6: 57,002,698 Y115S probably benign Het
Vmn2r44 A G 7: 8,380,301 I98T possibly damaging Het
Zfp462 A G 4: 55,010,668 Y878C probably damaging Het
Zfp474 T C 18: 52,638,431 I52T possibly damaging Het
Other mutations in Gbp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Gbp11 APN 5 105327616 critical splice acceptor site probably null
IGL01347:Gbp11 APN 5 105331328 splice site probably benign
IGL01762:Gbp11 APN 5 105327607 missense probably benign
IGL02157:Gbp11 APN 5 105327508 missense possibly damaging 0.95
Quilt UTSW 5 105325508 missense probably damaging 1.00
Tilted UTSW 5 105331053 missense probably damaging 1.00
R0550:Gbp11 UTSW 5 105343750 missense probably benign 0.28
R0647:Gbp11 UTSW 5 105330964 missense possibly damaging 0.93
R1530:Gbp11 UTSW 5 105327489 missense probably damaging 0.99
R1612:Gbp11 UTSW 5 105326596 missense possibly damaging 0.72
R1677:Gbp11 UTSW 5 105327411 missense probably damaging 1.00
R1738:Gbp11 UTSW 5 105326644 missense probably benign 0.02
R2063:Gbp11 UTSW 5 105328584 nonsense probably null
R2869:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2869:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2870:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2870:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R2873:Gbp11 UTSW 5 105331000 missense probably benign 0.00
R3915:Gbp11 UTSW 5 105331112 missense probably damaging 1.00
R5140:Gbp11 UTSW 5 105331053 missense probably damaging 1.00
R5534:Gbp11 UTSW 5 105331038 missense probably damaging 1.00
R6091:Gbp11 UTSW 5 105331388 missense possibly damaging 0.95
R6336:Gbp11 UTSW 5 105325489
R6351:Gbp11 UTSW 5 105327598 missense probably benign 0.07
R6956:Gbp11 UTSW 5 105328375 critical splice donor site probably null
R7371:Gbp11 UTSW 5 105342105 missense probably benign 0.06
R7393:Gbp11 UTSW 5 105327577 missense possibly damaging 0.60
R7410:Gbp11 UTSW 5 105343908 missense probably damaging 1.00
R7443:Gbp11 UTSW 5 105330950 critical splice donor site probably null
R7898:Gbp11 UTSW 5 105324932 missense probably benign 0.00
R8465:Gbp11 UTSW 5 105325062 missense probably benign 0.00
R8467:Gbp11 UTSW 5 105327591 missense probably damaging 1.00
R8672:Gbp11 UTSW 5 105343809 missense probably damaging 1.00
R8960:Gbp11 UTSW 5 105331385 missense probably damaging 0.98
R9097:Gbp11 UTSW 5 105326481 makesense probably null
Predicted Primers PCR Primer
(F):5'- GAAGACCATGCCCATGTGAC -3'
(R):5'- AGCCACAGGTCAGGAAGTATCC -3'

Sequencing Primer
(F):5'- TTCCAGGGTGGGCATCC -3'
(R):5'- GGAAGTATCCAGGGCCACTG -3'
Posted On2016-03-01