Incidental Mutation 'R4854:Agbl3'
ID 373779
Institutional Source Beutler Lab
Gene Symbol Agbl3
Ensembl Gene ENSMUSG00000038836
Gene Name ATP/GTP binding protein-like 3
Synonyms 4930431N21Rik, 2900053G10Rik, 6530406M24Rik
MMRRC Submission 042465-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4854 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 34780432-34859459 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34785284 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 73 (R73Q)
Ref Sequence ENSEMBL: ENSMUSP00000116066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115009] [ENSMUST00000115012] [ENSMUST00000115014] [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]
AlphaFold Q8CDP0
Predicted Effect probably benign
Transcript: ENSMUST00000115009
Predicted Effect probably benign
Transcript: ENSMUST00000115012
Predicted Effect possibly damaging
Transcript: ENSMUST00000115014
AA Change: R73Q

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110666
Gene: ENSMUSG00000038836
AA Change: R73Q

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115016
AA Change: R73Q

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: R73Q

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 314 563 2.7e-19 PFAM
low complexity region 614 629 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115017
AA Change: R73Q

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: R73Q

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 309 560 1e-33 PFAM
low complexity region 609 624 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119745
Predicted Effect probably damaging
Transcript: ENSMUST00000135304
AA Change: R73Q

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836
AA Change: R73Q

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143474
Predicted Effect probably damaging
Transcript: ENSMUST00000148834
AA Change: R73Q

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836
AA Change: R73Q

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202017
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (103/105)
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik T A 9: 22,208,037 noncoding transcript Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Abl1 T C 2: 31,779,010 Y110H probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Agl C T 3: 116,778,618 probably null Het
Amotl1 G A 9: 14,593,451 Q191* probably null Het
Apbb1ip A G 2: 22,853,202 K349E possibly damaging Het
Arhgap10 G A 8: 77,420,089 Q229* probably null Het
Aspm C T 1: 139,478,072 Q1566* probably null Het
B3gnt3 G A 8: 71,692,873 R284C probably damaging Het
Brd4 A G 17: 32,220,237 V423A probably damaging Het
Btbd9 A T 17: 30,524,865 I221N probably damaging Het
Camp A G 9: 109,847,451 V168A probably benign Het
Cd1d2 T A 3: 86,989,249 probably null Het
Cdkn2d A T 9: 21,290,927 V8D probably benign Het
Clec4g T C 8: 3,716,534 N256D probably damaging Het
Clspn A G 4: 126,575,950 I771V probably benign Het
Cntn6 A G 6: 104,859,475 E862G possibly damaging Het
Col6a5 T C 9: 105,898,751 T1702A probably benign Het
Dnah7a T C 1: 53,706,729 probably benign Het
Dubr T C 16: 50,732,523 noncoding transcript Het
Dusp26 G A 8: 31,094,137 V91M probably damaging Het
Edc4 A T 8: 105,887,925 probably benign Het
F5 C T 1: 164,192,146 A730V probably damaging Het
Foxf1 A G 8: 121,086,814 T358A probably benign Het
Frem1 A T 4: 82,916,758 N1810K possibly damaging Het
Galc A T 12: 98,256,877 F87I probably damaging Het
Gars A G 6: 55,046,418 D66G probably damaging Het
Gbp11 G A 5: 105,325,508 L460F probably damaging Het
Gdf7 T C 12: 8,298,014 I436V probably damaging Het
Gigyf2 C T 1: 87,354,413 probably benign Het
Gm12239 T C 11: 56,015,953 noncoding transcript Het
Gm5592 A C 7: 41,217,471 probably benign Het
Gp2 A T 7: 119,452,199 D264E possibly damaging Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Grid1 A G 14: 35,321,641 I318V probably benign Het
Grm2 C A 9: 106,654,132 V53F possibly damaging Het
Gtpbp1 T C 15: 79,719,205 S632P probably benign Het
H2-M1 A G 17: 36,670,058 F329L probably benign Het
Hecw1 T A 13: 14,316,892 D92V probably benign Het
Hgh1 T C 15: 76,369,182 L76P probably damaging Het
Idi2 C A 13: 8,957,843 N63K probably benign Het
Ift122 A G 6: 115,862,746 T25A possibly damaging Het
Itgb2l A T 16: 96,426,117 C575* probably null Het
Jup A G 11: 100,383,041 S225P possibly damaging Het
Kcng3 A T 17: 83,588,306 C244S probably damaging Het
Klhl2 T A 8: 64,834,459 M46L possibly damaging Het
Ksr1 A T 11: 79,027,702 I460N probably damaging Het
Lama3 T A 18: 12,411,542 F314Y probably benign Het
Lbp T C 2: 158,327,518 V421A possibly damaging Het
Lcp1 G A 14: 75,200,489 G113D probably damaging Het
Lrp1b A T 2: 41,111,077 L2045H probably damaging Het
Mbd2 G T 18: 70,568,735 D107Y unknown Het
Ms4a14 C T 19: 11,310,369 V96I possibly damaging Het
N4bp2l2 C T 5: 150,662,051 E155K probably benign Het
Nbeal2 T G 9: 110,631,396 H1790P probably damaging Het
Nsg2 G A 11: 32,031,806 G84R probably benign Het
Odf3 A G 7: 140,849,462 Y168C probably damaging Het
Olfr1145 A G 2: 87,810,590 T257A probably damaging Het
Olfr286 A C 15: 98,227,544 F34V possibly damaging Het
P2rx2 T C 5: 110,340,927 N224D probably damaging Het
P2rx5 A T 11: 73,171,779 E438V probably benign Het
Paip1 C A 13: 119,449,889 probably benign Het
Pik3c2g T A 6: 139,768,779 V219E probably damaging Het
Ppp1r12b T C 1: 134,873,951 E509G probably damaging Het
Ppp1r15a T C 7: 45,525,373 S4G probably benign Het
Ppp5c T C 7: 17,009,022 S224G probably benign Het
Prr30 T G 14: 101,198,443 I228L probably benign Het
Purg A G 8: 33,387,314 I327V possibly damaging Het
Ralb T C 1: 119,475,915 T161A probably benign Het
Ripor3 T C 2: 167,992,813 R253G probably benign Het
Scgb2b6 T C 7: 31,617,832 noncoding transcript Het
Setd5 G T 6: 113,151,399 G1438W probably damaging Het
Sh3rf3 T A 10: 58,813,723 L50Q possibly damaging Het
Sipa1l2 G T 8: 125,473,601 T662K probably damaging Het
Skint5 A G 4: 113,580,528 L1021S unknown Het
Slc22a23 T C 13: 34,203,941 S391G probably benign Het
Slc4a5 G A 6: 83,271,017 V402I probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Spink5 A T 18: 44,020,841 *1018C probably null Het
Stag3 T A 5: 138,296,694 probably null Het
Tmem117 T C 15: 95,094,688 F410L probably damaging Het
Tmod1 A G 4: 46,090,920 K158E possibly damaging Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Traf4 G A 11: 78,161,520 Q100* probably null Het
Trpc4 A G 3: 54,302,218 Y668C probably damaging Het
Ttn T A 2: 76,767,583 N11335I possibly damaging Het
Uhrf1bp1l T G 10: 89,794,484 V382G probably damaging Het
Usp39 A T 6: 72,325,682 V463E probably benign Het
Vmn1r6 A C 6: 57,002,698 Y115S probably benign Het
Vmn2r44 A G 7: 8,380,301 I98T possibly damaging Het
Zfp462 A G 4: 55,010,668 Y878C probably damaging Het
Zfp474 T C 18: 52,638,431 I52T possibly damaging Het
Other mutations in Agbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Agbl3 APN 6 34846836 missense probably damaging 1.00
IGL00835:Agbl3 APN 6 34799732 missense probably damaging 1.00
IGL00840:Agbl3 APN 6 34799159 missense possibly damaging 0.95
IGL01090:Agbl3 APN 6 34799887 missense probably benign 0.40
IGL01123:Agbl3 APN 6 34846976 nonsense probably null
IGL01707:Agbl3 APN 6 34839454 missense possibly damaging 0.78
IGL01728:Agbl3 APN 6 34782157 start codon destroyed probably null
IGL02335:Agbl3 APN 6 34799750 missense probably damaging 1.00
IGL02420:Agbl3 APN 6 34785307 missense possibly damaging 0.47
IGL02551:Agbl3 APN 6 34823071 missense possibly damaging 0.88
IGL02974:Agbl3 APN 6 34799822 missense probably damaging 1.00
IGL03167:Agbl3 APN 6 34857659 missense possibly damaging 0.92
IGL03182:Agbl3 APN 6 34803500 missense probably damaging 1.00
R0044:Agbl3 UTSW 6 34799899 missense probably damaging 1.00
R0499:Agbl3 UTSW 6 34839335 missense probably benign
R0639:Agbl3 UTSW 6 34799705 missense probably damaging 1.00
R0850:Agbl3 UTSW 6 34799204 missense probably damaging 1.00
R1004:Agbl3 UTSW 6 34803451 missense probably damaging 0.99
R1080:Agbl3 UTSW 6 34828235 missense probably benign 0.14
R1589:Agbl3 UTSW 6 34857517 missense possibly damaging 0.77
R2361:Agbl3 UTSW 6 34832505 missense possibly damaging 0.87
R2495:Agbl3 UTSW 6 34846764 missense probably damaging 1.00
R3236:Agbl3 UTSW 6 34823087 splice site probably null
R3237:Agbl3 UTSW 6 34823087 splice site probably null
R3420:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3421:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3422:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3810:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R3811:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R4059:Agbl3 UTSW 6 34846899 missense probably damaging 1.00
R4499:Agbl3 UTSW 6 34857598 missense probably benign 0.00
R4687:Agbl3 UTSW 6 34798326 missense probably damaging 1.00
R5354:Agbl3 UTSW 6 34814752 missense probably benign 0.03
R5386:Agbl3 UTSW 6 34799196 missense probably damaging 1.00
R5897:Agbl3 UTSW 6 34803573 missense probably benign 0.21
R6018:Agbl3 UTSW 6 34799255 missense probably damaging 1.00
R6148:Agbl3 UTSW 6 34857753 missense possibly damaging 0.87
R6305:Agbl3 UTSW 6 34782210 missense unknown
R6525:Agbl3 UTSW 6 34803594 nonsense probably null
R6546:Agbl3 UTSW 6 34799299 missense probably damaging 1.00
R6743:Agbl3 UTSW 6 34846953 missense probably benign 0.03
R6986:Agbl3 UTSW 6 34839452 missense probably benign 0.42
R7023:Agbl3 UTSW 6 34814769 missense probably benign 0.02
R7411:Agbl3 UTSW 6 34814819 missense probably damaging 0.99
R7469:Agbl3 UTSW 6 34814414 missense probably damaging 1.00
R7631:Agbl3 UTSW 6 34857671 missense possibly damaging 0.95
R7658:Agbl3 UTSW 6 34832508 missense probably benign 0.11
R7743:Agbl3 UTSW 6 34846830 missense probably damaging 1.00
R7801:Agbl3 UTSW 6 34839365 missense probably benign 0.00
R8033:Agbl3 UTSW 6 34839494 missense possibly damaging 0.95
R8203:Agbl3 UTSW 6 34799479 missense probably damaging 1.00
R8769:Agbl3 UTSW 6 34857614 missense probably damaging 0.96
R9072:Agbl3 UTSW 6 34799452 missense probably damaging 1.00
R9073:Agbl3 UTSW 6 34799452 missense probably damaging 1.00
R9210:Agbl3 UTSW 6 34798242 missense probably damaging 0.98
R9255:Agbl3 UTSW 6 34812905 missense probably damaging 1.00
R9536:Agbl3 UTSW 6 34846926 missense probably benign
R9560:Agbl3 UTSW 6 34846908 missense possibly damaging 0.94
R9662:Agbl3 UTSW 6 34832533 nonsense probably null
RF014:Agbl3 UTSW 6 34799358 missense possibly damaging 0.53
Z1177:Agbl3 UTSW 6 34799408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTAGCTATTATGAAGATCAGTTGA -3'
(R):5'- CAGTTGTTACATCATTAGTGTCCTCA -3'

Sequencing Primer
(F):5'- CTGGTCACTCATGACTGT -3'
(R):5'- AGTGTCCTCATTAACATCAAGATTG -3'
Posted On 2016-03-01