Incidental Mutation 'R4854:Gars'
ID 373780
Institutional Source Beutler Lab
Gene Symbol Gars
Ensembl Gene ENSMUSG00000029777
Gene Name glycyl-tRNA synthetase
Synonyms GENA202, Sgrp23, Gena201
MMRRC Submission 042465-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4854 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 55038007-55079500 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55046418 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 66 (D66G)
Ref Sequence ENSEMBL: ENSMUSP00000003572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003572]
AlphaFold Q9CZD3
Predicted Effect probably damaging
Transcript: ENSMUST00000003572
AA Change: D66G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003572
Gene: ENSMUSG00000029777
AA Change: D66G

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
WHEP-TRS 57 112 1.58e-8 SMART
Pfam:tRNA-synt_2b 281 582 2.1e-10 PFAM
Pfam:HGTP_anticodon 605 699 7.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205258
Meta Mutation Damage Score 0.3694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glycyl-tRNA synthetase, one of the aminoacyl-tRNA synthetases that charge tRNAs with their cognate amino acids. The encoded enzyme is an (alpha)2 dimer which belongs to the class II family of tRNA synthetases. It has been shown to be a target of autoantibodies in the human autoimmune diseases, polymyositis or dermatomyositis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: A dominant mutation results in sensory and motor axon degeneration in affected mice, with defects in synaptic transmission, nerve conduction and premature death. A loss of function mutation results in embryonic lethality in homozygous mice, and no discernable phenotype in heterozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik T A 9: 22,208,037 noncoding transcript Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abl1 T C 2: 31,779,010 Y110H probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Agbl3 G A 6: 34,785,284 R73Q probably damaging Het
Agl C T 3: 116,778,618 probably null Het
Amotl1 G A 9: 14,593,451 Q191* probably null Het
Apbb1ip A G 2: 22,853,202 K349E possibly damaging Het
Arhgap10 G A 8: 77,420,089 Q229* probably null Het
Aspm C T 1: 139,478,072 Q1566* probably null Het
B3gnt3 G A 8: 71,692,873 R284C probably damaging Het
Brd4 A G 17: 32,220,237 V423A probably damaging Het
Btbd9 A T 17: 30,524,865 I221N probably damaging Het
Camp A G 9: 109,847,451 V168A probably benign Het
Cd1d2 T A 3: 86,989,249 probably null Het
Cdkn2d A T 9: 21,290,927 V8D probably benign Het
Clec4g T C 8: 3,716,534 N256D probably damaging Het
Clspn A G 4: 126,575,950 I771V probably benign Het
Cntn6 A G 6: 104,859,475 E862G possibly damaging Het
Col6a5 T C 9: 105,898,751 T1702A probably benign Het
Dnah7a T C 1: 53,706,729 probably benign Het
Dubr T C 16: 50,732,523 noncoding transcript Het
Dusp26 G A 8: 31,094,137 V91M probably damaging Het
Edc4 A T 8: 105,887,925 probably benign Het
F5 C T 1: 164,192,146 A730V probably damaging Het
Foxf1 A G 8: 121,086,814 T358A probably benign Het
Frem1 A T 4: 82,916,758 N1810K possibly damaging Het
Galc A T 12: 98,256,877 F87I probably damaging Het
Gbp11 G A 5: 105,325,508 L460F probably damaging Het
Gdf7 T C 12: 8,298,014 I436V probably damaging Het
Gigyf2 C T 1: 87,354,413 probably benign Het
Gm12239 T C 11: 56,015,953 noncoding transcript Het
Gm5592 A C 7: 41,217,471 probably benign Het
Gp2 A T 7: 119,452,199 D264E possibly damaging Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Grid1 A G 14: 35,321,641 I318V probably benign Het
Grm2 C A 9: 106,654,132 V53F possibly damaging Het
Gtpbp1 T C 15: 79,719,205 S632P probably benign Het
H2-M1 A G 17: 36,670,058 F329L probably benign Het
Hecw1 T A 13: 14,316,892 D92V probably benign Het
Hgh1 T C 15: 76,369,182 L76P probably damaging Het
Idi2 C A 13: 8,957,843 N63K probably benign Het
Ift122 A G 6: 115,862,746 T25A possibly damaging Het
Itgb2l A T 16: 96,426,117 C575* probably null Het
Jup A G 11: 100,383,041 S225P possibly damaging Het
Kcng3 A T 17: 83,588,306 C244S probably damaging Het
Klhl2 T A 8: 64,834,459 M46L possibly damaging Het
Ksr1 A T 11: 79,027,702 I460N probably damaging Het
Lama3 T A 18: 12,411,542 F314Y probably benign Het
Lbp T C 2: 158,327,518 V421A possibly damaging Het
Lcp1 G A 14: 75,200,489 G113D probably damaging Het
Lrp1b A T 2: 41,111,077 L2045H probably damaging Het
Mbd2 G T 18: 70,568,735 D107Y unknown Het
Ms4a14 C T 19: 11,310,369 V96I possibly damaging Het
N4bp2l2 C T 5: 150,662,051 E155K probably benign Het
Nbeal2 T G 9: 110,631,396 H1790P probably damaging Het
Nsg2 G A 11: 32,031,806 G84R probably benign Het
Odf3 A G 7: 140,849,462 Y168C probably damaging Het
Olfr1145 A G 2: 87,810,590 T257A probably damaging Het
Olfr286 A C 15: 98,227,544 F34V possibly damaging Het
P2rx2 T C 5: 110,340,927 N224D probably damaging Het
P2rx5 A T 11: 73,171,779 E438V probably benign Het
Paip1 C A 13: 119,449,889 probably benign Het
Pik3c2g T A 6: 139,768,779 V219E probably damaging Het
Ppp1r12b T C 1: 134,873,951 E509G probably damaging Het
Ppp1r15a T C 7: 45,525,373 S4G probably benign Het
Ppp5c T C 7: 17,009,022 S224G probably benign Het
Prr30 T G 14: 101,198,443 I228L probably benign Het
Purg A G 8: 33,387,314 I327V possibly damaging Het
Ralb T C 1: 119,475,915 T161A probably benign Het
Ripor3 T C 2: 167,992,813 R253G probably benign Het
Scgb2b6 T C 7: 31,617,832 noncoding transcript Het
Setd5 G T 6: 113,151,399 G1438W probably damaging Het
Sh3rf3 T A 10: 58,813,723 L50Q possibly damaging Het
Sipa1l2 G T 8: 125,473,601 T662K probably damaging Het
Skint5 A G 4: 113,580,528 L1021S unknown Het
Slc22a23 T C 13: 34,203,941 S391G probably benign Het
Slc4a5 G A 6: 83,271,017 V402I probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Spink5 A T 18: 44,020,841 *1018C probably null Het
Stag3 T A 5: 138,296,694 probably null Het
Tmem117 T C 15: 95,094,688 F410L probably damaging Het
Tmod1 A G 4: 46,090,920 K158E possibly damaging Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Traf4 G A 11: 78,161,520 Q100* probably null Het
Trpc4 A G 3: 54,302,218 Y668C probably damaging Het
Ttn T A 2: 76,767,583 N11335I possibly damaging Het
Uhrf1bp1l T G 10: 89,794,484 V382G probably damaging Het
Usp39 A T 6: 72,325,682 V463E probably benign Het
Vmn1r6 A C 6: 57,002,698 Y115S probably benign Het
Vmn2r44 A G 7: 8,380,301 I98T possibly damaging Het
Zfp462 A G 4: 55,010,668 Y878C probably damaging Het
Zfp474 T C 18: 52,638,431 I52T possibly damaging Het
Other mutations in Gars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Gars APN 6 55050353 missense probably damaging 1.00
IGL01084:Gars APN 6 55055827 missense probably benign
IGL01514:Gars APN 6 55065520 missense probably benign 0.01
IGL02104:Gars APN 6 55077697 missense probably damaging 1.00
IGL02349:Gars APN 6 55048064 splice site probably benign
IGL02371:Gars APN 6 55065467 missense probably benign 0.08
IGL02932:Gars APN 6 55060944 missense probably damaging 1.00
BB006:Gars UTSW 6 55063117 missense probably damaging 1.00
BB016:Gars UTSW 6 55063117 missense probably damaging 1.00
IGL02799:Gars UTSW 6 55063099 missense probably damaging 1.00
R0637:Gars UTSW 6 55069487 critical splice donor site probably null
R0762:Gars UTSW 6 55077580 splice site probably null
R1451:Gars UTSW 6 55053123 splice site probably benign
R1846:Gars UTSW 6 55063168 missense probably benign 0.05
R1988:Gars UTSW 6 55077772 missense probably null 0.00
R2033:Gars UTSW 6 55077723 missense probably benign 0.02
R2566:Gars UTSW 6 55065563 missense probably damaging 1.00
R4706:Gars UTSW 6 55069378 missense probably damaging 0.99
R5055:Gars UTSW 6 55068092 missense probably damaging 1.00
R5558:Gars UTSW 6 55065607 missense probably damaging 1.00
R6306:Gars UTSW 6 55055824 missense probably damaging 1.00
R6821:Gars UTSW 6 55079338 missense probably benign 0.00
R7376:Gars UTSW 6 55073359 missense probably benign 0.00
R7505:Gars UTSW 6 55052177 missense probably benign 0.00
R7579:Gars UTSW 6 55077703 missense probably damaging 1.00
R7605:Gars UTSW 6 55077750 missense probably damaging 1.00
R7728:Gars UTSW 6 55050386 missense probably damaging 1.00
R7929:Gars UTSW 6 55063117 missense probably damaging 1.00
R8014:Gars UTSW 6 55073407 missense probably benign
R8391:Gars UTSW 6 55048142 missense probably damaging 1.00
R8418:Gars UTSW 6 55065461 missense probably damaging 0.99
R8704:Gars UTSW 6 55063230 missense probably damaging 0.98
R9350:Gars UTSW 6 55052264 missense probably null 0.57
Predicted Primers PCR Primer
(F):5'- GTTCTCCTGGACAGTGCATG -3'
(R):5'- GAGTGGCACTTGTTCAGAAAGC -3'

Sequencing Primer
(F):5'- ACAGTGCATGCTGTGGAC -3'
(R):5'- GCACTTGTTCAGAAAGCTTTTGAG -3'
Posted On 2016-03-01