Mutagenetix > Incidental Mutation

Incidental Mutation 'R4854:Pik3c2g'

373787

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2g

Ensembl Gene

ENSMUSG00000030228

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma

Synonyms

MMRRC Submission

042465-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R4854 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139587221-139969284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139768779 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 219 (V219E)

Ref Sequence

ENSEMBL: ENSMUSP00000151281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111868] [ENSMUST00000218528]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000111868
AA Change: V337E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: V337E

Domain	Start	End	E-Value	Type
SCOP:d1e8xa2	1	83	4e-16	SMART
PI3Ka	103	288	7.6e-29	SMART
PI3Kc	375	637	2.11e-109	SMART
PX	661	765	1.24e-21	SMART
C2	800	897	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187069

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191013

Predicted Effect

probably damaging
Transcript: ENSMUST00000218528
AA Change: V219E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (103/105)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810064F22Rik	T	A	9: 22,208,037		noncoding transcript	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abl1	T	C	2: 31,779,010	Y110H	probably damaging	Het
Ablim2	C	T	5: 35,802,422	R73C	possibly damaging	Het
Agbl3	G	A	6: 34,785,284	R73Q	probably damaging	Het
Agl	C	T	3: 116,778,618		probably null	Het
Amotl1	G	A	9: 14,593,451	Q191*	probably null	Het
Apbb1ip	A	G	2: 22,853,202	K349E	possibly damaging	Het
Arhgap10	G	A	8: 77,420,089	Q229*	probably null	Het
Aspm	C	T	1: 139,478,072	Q1566*	probably null	Het
B3gnt3	G	A	8: 71,692,873	R284C	probably damaging	Het
Brd4	A	G	17: 32,220,237	V423A	probably damaging	Het
Btbd9	A	T	17: 30,524,865	I221N	probably damaging	Het
Camp	A	G	9: 109,847,451	V168A	probably benign	Het
Cd1d2	T	A	3: 86,989,249		probably null	Het
Cdkn2d	A	T	9: 21,290,927	V8D	probably benign	Het
Clec4g	T	C	8: 3,716,534	N256D	probably damaging	Het
Clspn	A	G	4: 126,575,950	I771V	probably benign	Het
Cntn6	A	G	6: 104,859,475	E862G	possibly damaging	Het
Col6a5	T	C	9: 105,898,751	T1702A	probably benign	Het
Dnah7a	T	C	1: 53,706,729		probably benign	Het
Dubr	T	C	16: 50,732,523		noncoding transcript	Het
Dusp26	G	A	8: 31,094,137	V91M	probably damaging	Het
Edc4	A	T	8: 105,887,925		probably benign	Het
F5	C	T	1: 164,192,146	A730V	probably damaging	Het
Foxf1	A	G	8: 121,086,814	T358A	probably benign	Het
Frem1	A	T	4: 82,916,758	N1810K	possibly damaging	Het
Galc	A	T	12: 98,256,877	F87I	probably damaging	Het
Gars	A	G	6: 55,046,418	D66G	probably damaging	Het
Gbp11	G	A	5: 105,325,508	L460F	probably damaging	Het
Gdf7	T	C	12: 8,298,014	I436V	probably damaging	Het
Gigyf2	C	T	1: 87,354,413		probably benign	Het
Gm12239	T	C	11: 56,015,953		noncoding transcript	Het
Gm5592	A	C	7: 41,217,471		probably benign	Het
Gp2	A	T	7: 119,452,199	D264E	possibly damaging	Het
Gphn	G	A	12: 78,627,210	V526M	probably damaging	Het
Grid1	A	G	14: 35,321,641	I318V	probably benign	Het
Grm2	C	A	9: 106,654,132	V53F	possibly damaging	Het
Gtpbp1	T	C	15: 79,719,205	S632P	probably benign	Het
H2-M1	A	G	17: 36,670,058	F329L	probably benign	Het
Hecw1	T	A	13: 14,316,892	D92V	probably benign	Het
Hgh1	T	C	15: 76,369,182	L76P	probably damaging	Het
Idi2	C	A	13: 8,957,843	N63K	probably benign	Het
Ift122	A	G	6: 115,862,746	T25A	possibly damaging	Het
Itgb2l	A	T	16: 96,426,117	C575*	probably null	Het
Jup	A	G	11: 100,383,041	S225P	possibly damaging	Het
Kcng3	A	T	17: 83,588,306	C244S	probably damaging	Het
Klhl2	T	A	8: 64,834,459	M46L	possibly damaging	Het
Ksr1	A	T	11: 79,027,702	I460N	probably damaging	Het
Lama3	T	A	18: 12,411,542	F314Y	probably benign	Het
Lbp	T	C	2: 158,327,518	V421A	possibly damaging	Het
Lcp1	G	A	14: 75,200,489	G113D	probably damaging	Het
Lrp1b	A	T	2: 41,111,077	L2045H	probably damaging	Het
Mbd2	G	T	18: 70,568,735	D107Y	unknown	Het
Ms4a14	C	T	19: 11,310,369	V96I	possibly damaging	Het
N4bp2l2	C	T	5: 150,662,051	E155K	probably benign	Het
Nbeal2	T	G	9: 110,631,396	H1790P	probably damaging	Het
Nsg2	G	A	11: 32,031,806	G84R	probably benign	Het
Odf3	A	G	7: 140,849,462	Y168C	probably damaging	Het
Olfr1145	A	G	2: 87,810,590	T257A	probably damaging	Het
Olfr286	A	C	15: 98,227,544	F34V	possibly damaging	Het
P2rx2	T	C	5: 110,340,927	N224D	probably damaging	Het
P2rx5	A	T	11: 73,171,779	E438V	probably benign	Het
Paip1	C	A	13: 119,449,889		probably benign	Het
Ppp1r12b	T	C	1: 134,873,951	E509G	probably damaging	Het
Ppp1r15a	T	C	7: 45,525,373	S4G	probably benign	Het
Ppp5c	T	C	7: 17,009,022	S224G	probably benign	Het
Prr30	T	G	14: 101,198,443	I228L	probably benign	Het
Purg	A	G	8: 33,387,314	I327V	possibly damaging	Het
Ralb	T	C	1: 119,475,915	T161A	probably benign	Het
Ripor3	T	C	2: 167,992,813	R253G	probably benign	Het
Scgb2b6	T	C	7: 31,617,832		noncoding transcript	Het
Setd5	G	T	6: 113,151,399	G1438W	probably damaging	Het
Sh3rf3	T	A	10: 58,813,723	L50Q	possibly damaging	Het
Sipa1l2	G	T	8: 125,473,601	T662K	probably damaging	Het
Skint5	A	G	4: 113,580,528	L1021S	unknown	Het
Slc22a23	T	C	13: 34,203,941	S391G	probably benign	Het
Slc4a5	G	A	6: 83,271,017	V402I	probably benign	Het
Slco4c1	G	A	1: 96,841,228	P303L	probably damaging	Het
Spink5	A	T	18: 44,020,841	*1018C	probably null	Het
Stag3	T	A	5: 138,296,694		probably null	Het
Tmem117	T	C	15: 95,094,688	F410L	probably damaging	Het
Tmod1	A	G	4: 46,090,920	K158E	possibly damaging	Het
Tpsb2	GGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTG	17: 25,366,562		probably benign	Het
Traf4	G	A	11: 78,161,520	Q100*	probably null	Het
Trpc4	A	G	3: 54,302,218	Y668C	probably damaging	Het
Ttn	T	A	2: 76,767,583	N11335I	possibly damaging	Het
Uhrf1bp1l	T	G	10: 89,794,484	V382G	probably damaging	Het
Usp39	A	T	6: 72,325,682	V463E	probably benign	Het
Vmn1r6	A	C	6: 57,002,698	Y115S	probably benign	Het
Vmn2r44	A	G	7: 8,380,301	I98T	possibly damaging	Het
Zfp462	A	G	4: 55,010,668	Y878C	probably damaging	Het
Zfp474	T	C	18: 52,638,431	I52T	possibly damaging	Het

Other mutations in Pik3c2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pik3c2g	APN	6	139896125	missense	probably damaging	1.00
IGL01355:Pik3c2g	APN	6	139852857	missense	probably damaging	0.98
IGL01579:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01580:Pik3c2g	APN	6	139622516	missense	probably damaging	0.99
IGL01587:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01813:Pik3c2g	APN	6	139622409	missense	possibly damaging	0.55
IGL02218:Pik3c2g	APN	6	139860355	missense	probably damaging	1.00
IGL02479:Pik3c2g	APN	6	139918004	missense	probably benign	0.40
IGL02480:Pik3c2g	APN	6	139852800	missense	probably damaging	1.00
IGL02721:Pik3c2g	APN	6	139736973	missense	probably benign	0.15
IGL02967:Pik3c2g	APN	6	139967828	missense	probably damaging	0.98
IGL03221:Pik3c2g	APN	6	139772407	critical splice acceptor site	probably null
FR4304:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4340:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4976:Pik3c2g	UTSW	6	139635654	frame shift	probably null
IGL02837:Pik3c2g	UTSW	6	139626564	nonsense	probably null
PIT4531001:Pik3c2g	UTSW	6	139859370	missense
R0002:Pik3c2g	UTSW	6	139768745	missense	probably benign	0.08
R0081:Pik3c2g	UTSW	6	139957793	missense	probably benign	0.05
R0098:Pik3c2g	UTSW	6	139662443	missense	unknown
R0719:Pik3c2g	UTSW	6	139629725	missense	probably damaging	1.00
R0740:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R0837:Pik3c2g	UTSW	6	139957699	splice site	probably benign
R0840:Pik3c2g	UTSW	6	139896072	missense	probably damaging	1.00
R1306:Pik3c2g	UTSW	6	139772428	missense	probably benign
R1501:Pik3c2g	UTSW	6	139844070	critical splice donor site	probably null
R1591:Pik3c2g	UTSW	6	139748178	missense	probably benign	0.00
R1666:Pik3c2g	UTSW	6	139635636	intron	probably benign
R1907:Pik3c2g	UTSW	6	139844042	missense	probably damaging	1.00
R1970:Pik3c2g	UTSW	6	139900386	critical splice donor site	probably null
R1982:Pik3c2g	UTSW	6	139622548	missense	probably damaging	0.97
R2171:Pik3c2g	UTSW	6	139855286	nonsense	probably null
R2188:Pik3c2g	UTSW	6	139852874	missense	probably damaging	1.00
R3777:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3778:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3965:Pik3c2g	UTSW	6	139855292	missense	possibly damaging	0.90
R4076:Pik3c2g	UTSW	6	139852863	missense	probably damaging	1.00
R4078:Pik3c2g	UTSW	6	139635610	intron	probably benign
R4108:Pik3c2g	UTSW	6	139730370	missense	probably benign	0.00
R4461:Pik3c2g	UTSW	6	139841681	intron	probably benign
R4474:Pik3c2g	UTSW	6	139633751	missense	probably damaging	0.99
R4509:Pik3c2g	UTSW	6	139720006	missense	probably benign	0.25
R4646:Pik3c2g	UTSW	6	139720018	missense	probably benign	0.05
R4732:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4733:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4928:Pik3c2g	UTSW	6	139967802	missense	possibly damaging	0.88
R4959:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R4973:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R5032:Pik3c2g	UTSW	6	139896202	missense	probably benign	0.00
R5071:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5072:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5073:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5074:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5107:Pik3c2g	UTSW	6	139635625	intron	probably benign
R5186:Pik3c2g	UTSW	6	139622018	missense	probably damaging	1.00
R5253:Pik3c2g	UTSW	6	139896257	critical splice donor site	probably null
R5359:Pik3c2g	UTSW	6	139622123	missense	probably damaging	1.00
R5394:Pik3c2g	UTSW	6	139720082	missense	probably benign
R5417:Pik3c2g	UTSW	6	139736943	missense	probably benign
R5435:Pik3c2g	UTSW	6	139715855	splice site	probably null
R5580:Pik3c2g	UTSW	6	139626533	missense	probably damaging	0.99
R5664:Pik3c2g	UTSW	6	139737007	missense	probably damaging	0.98
R5908:Pik3c2g	UTSW	6	139768710	missense
R5914:Pik3c2g	UTSW	6	139622479	missense	probably benign	0.00
R6046:Pik3c2g	UTSW	6	139622139	missense	probably damaging	0.96
R6046:Pik3c2g	UTSW	6	139896792	missense	probably damaging	1.00
R6298:Pik3c2g	UTSW	6	139626563	missense	probably damaging	1.00
R6382:Pik3c2g	UTSW	6	139719998	missense	possibly damaging	0.88
R6480:Pik3c2g	UTSW	6	139730469	missense	probably benign	0.27
R6917:Pik3c2g	UTSW	6	139896173	missense	probably benign	0.00
R6929:Pik3c2g	UTSW	6	139957776	missense	possibly damaging	0.67
R7022:Pik3c2g	UTSW	6	139622063	missense	possibly damaging	0.82
R7144:Pik3c2g	UTSW	6	139629870	missense	probably damaging	1.00
R7213:Pik3c2g	UTSW	6	139860264	missense
R7215:Pik3c2g	UTSW	6	139754863	missense
R7332:Pik3c2g	UTSW	6	139896255	missense
R7357:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7359:Pik3c2g	UTSW	6	139967894	missense	unknown
R7385:Pik3c2g	UTSW	6	139855353	missense
R7455:Pik3c2g	UTSW	6	139967917	missense	unknown
R7651:Pik3c2g	UTSW	6	139622072	missense	possibly damaging	0.85
R7888:Pik3c2g	UTSW	6	139896744	missense
R7923:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7964:Pik3c2g	UTSW	6	139882060	missense
R8005:Pik3c2g	UTSW	6	139622069	missense	probably benign	0.01
R8371:Pik3c2g	UTSW	6	139936056	missense	unknown
R8724:Pik3c2g	UTSW	6	139967893	missense	unknown
R8733:Pik3c2g	UTSW	6	139768700	nonsense	probably null
R8809:Pik3c2g	UTSW	6	139768710	missense
R8888:Pik3c2g	UTSW	6	139730366	nonsense	probably null
R8931:Pik3c2g	UTSW	6	139875367	missense	probably benign	0.02
R9188:Pik3c2g	UTSW	6	139622403	missense	possibly damaging	0.94
R9336:Pik3c2g	UTSW	6	139875435	missense
R9383:Pik3c2g	UTSW	6	139882016	nonsense	probably null
R9524:Pik3c2g	UTSW	6	139629770	missense	probably damaging	0.99
R9531:Pik3c2g	UTSW	6	139896200	missense
R9630:Pik3c2g	UTSW	6	139622239	missense	possibly damaging	0.66
R9697:Pik3c2g	UTSW	6	139967791	missense	unknown
R9708:Pik3c2g	UTSW	6	139629867	missense	probably benign
R9717:Pik3c2g	UTSW	6	139896184	missense
RF015:Pik3c2g	UTSW	6	139754771	missense
RF032:Pik3c2g	UTSW	6	139635658	frame shift	probably null
X0024:Pik3c2g	UTSW	6	139860258	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCACTAGAATTTACTCTGTGTCCT -3'
(R):5'- AACGTCTGTACTACCACGTGA -3'

Sequencing Primer
(F):5'- GTCATAAGACTTAGCTGCAGTCC -3'
(R):5'- GTCTGTACTACCACGTGAACCAC -3'

Posted On

2016-03-01