Mutagenetix > Incidental Mutation

Incidental Mutation 'R4854:Amotl1'

373803

Institutional Source

Beutler Lab

Gene Symbol

Amotl1

Ensembl Gene

ENSMUSG00000013076

Gene Name

angiomotin-like 1

Synonyms

JEAP, 2310067L22Rik, 2310010G08Rik, 4932416D09Rik

MMRRC Submission

042465-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.129) question?

Stock #

R4854 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14541966-14645056 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 14593451 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 191 (Q191*)

Ref Sequence

ENSEMBL: ENSMUSP00000152834 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013220] [ENSMUST00000162901] [ENSMUST00000223132]

AlphaFold

Q9D4H4

Predicted Effect

probably null
Transcript: ENSMUST00000013220
AA Change: Q154*

SMART Domains

Protein: ENSMUSP00000013220
Gene: ENSMUSG00000013076
AA Change: Q154*

Domain	Start	End	E-Value	Type
low complexity region	203	224	N/A	INTRINSIC
low complexity region	418	441	N/A	INTRINSIC
coiled coil region	449	472	N/A	INTRINSIC
Blast:PAC	491	532	1e-10	BLAST
low complexity region	562	575	N/A	INTRINSIC
Pfam:Angiomotin_C	616	822	4.4e-96	PFAM
low complexity region	853	878	N/A	INTRINSIC
low complexity region	881	895	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160770

SMART Domains

Protein: ENSMUSP00000124281
Gene: ENSMUSG00000013076

Domain	Start	End	E-Value	Type
low complexity region	117	138	N/A	INTRINSIC
low complexity region	332	355	N/A	INTRINSIC
coiled coil region	363	386	N/A	INTRINSIC
Blast:PAC	405	446	1e-10	BLAST
low complexity region	476	489	N/A	INTRINSIC
Pfam:Angiomotin_C	530	738	5.2e-95	PFAM
low complexity region	767	792	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162802

Predicted Effect

probably null
Transcript: ENSMUST00000162901
AA Change: Q68*

Predicted Effect

probably null
Transcript: ENSMUST00000162901
AA Change: Q68*

Predicted Effect

probably null
Transcript: ENSMUST00000223132
AA Change: Q191*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (103/105)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein that is a component of tight junctions or TJs. TJs form an apical junctional structure and act to control paracellular permeability and maintain cell polarity. This protein is related to angiomotin, an angiostatin binding protein that regulates endothelial cell migration and capillary formation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810064F22Rik	T	A	9: 22,208,037		noncoding transcript	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abl1	T	C	2: 31,779,010	Y110H	probably damaging	Het
Ablim2	C	T	5: 35,802,422	R73C	possibly damaging	Het
Agbl3	G	A	6: 34,785,284	R73Q	probably damaging	Het
Agl	C	T	3: 116,778,618		probably null	Het
Apbb1ip	A	G	2: 22,853,202	K349E	possibly damaging	Het
Arhgap10	G	A	8: 77,420,089	Q229*	probably null	Het
Aspm	C	T	1: 139,478,072	Q1566*	probably null	Het
B3gnt3	G	A	8: 71,692,873	R284C	probably damaging	Het
Brd4	A	G	17: 32,220,237	V423A	probably damaging	Het
Btbd9	A	T	17: 30,524,865	I221N	probably damaging	Het
Camp	A	G	9: 109,847,451	V168A	probably benign	Het
Cd1d2	T	A	3: 86,989,249		probably null	Het
Cdkn2d	A	T	9: 21,290,927	V8D	probably benign	Het
Clec4g	T	C	8: 3,716,534	N256D	probably damaging	Het
Clspn	A	G	4: 126,575,950	I771V	probably benign	Het
Cntn6	A	G	6: 104,859,475	E862G	possibly damaging	Het
Col6a5	T	C	9: 105,898,751	T1702A	probably benign	Het
Dnah7a	T	C	1: 53,706,729		probably benign	Het
Dubr	T	C	16: 50,732,523		noncoding transcript	Het
Dusp26	G	A	8: 31,094,137	V91M	probably damaging	Het
Edc4	A	T	8: 105,887,925		probably benign	Het
F5	C	T	1: 164,192,146	A730V	probably damaging	Het
Foxf1	A	G	8: 121,086,814	T358A	probably benign	Het
Frem1	A	T	4: 82,916,758	N1810K	possibly damaging	Het
Galc	A	T	12: 98,256,877	F87I	probably damaging	Het
Gars	A	G	6: 55,046,418	D66G	probably damaging	Het
Gbp11	G	A	5: 105,325,508	L460F	probably damaging	Het
Gdf7	T	C	12: 8,298,014	I436V	probably damaging	Het
Gigyf2	C	T	1: 87,354,413		probably benign	Het
Gm12239	T	C	11: 56,015,953		noncoding transcript	Het
Gm5592	A	C	7: 41,217,471		probably benign	Het
Gp2	A	T	7: 119,452,199	D264E	possibly damaging	Het
Gphn	G	A	12: 78,627,210	V526M	probably damaging	Het
Grid1	A	G	14: 35,321,641	I318V	probably benign	Het
Grm2	C	A	9: 106,654,132	V53F	possibly damaging	Het
Gtpbp1	T	C	15: 79,719,205	S632P	probably benign	Het
H2-M1	A	G	17: 36,670,058	F329L	probably benign	Het
Hecw1	T	A	13: 14,316,892	D92V	probably benign	Het
Hgh1	T	C	15: 76,369,182	L76P	probably damaging	Het
Idi2	C	A	13: 8,957,843	N63K	probably benign	Het
Ift122	A	G	6: 115,862,746	T25A	possibly damaging	Het
Itgb2l	A	T	16: 96,426,117	C575*	probably null	Het
Jup	A	G	11: 100,383,041	S225P	possibly damaging	Het
Kcng3	A	T	17: 83,588,306	C244S	probably damaging	Het
Klhl2	T	A	8: 64,834,459	M46L	possibly damaging	Het
Ksr1	A	T	11: 79,027,702	I460N	probably damaging	Het
Lama3	T	A	18: 12,411,542	F314Y	probably benign	Het
Lbp	T	C	2: 158,327,518	V421A	possibly damaging	Het
Lcp1	G	A	14: 75,200,489	G113D	probably damaging	Het
Lrp1b	A	T	2: 41,111,077	L2045H	probably damaging	Het
Mbd2	G	T	18: 70,568,735	D107Y	unknown	Het
Ms4a14	C	T	19: 11,310,369	V96I	possibly damaging	Het
N4bp2l2	C	T	5: 150,662,051	E155K	probably benign	Het
Nbeal2	T	G	9: 110,631,396	H1790P	probably damaging	Het
Nsg2	G	A	11: 32,031,806	G84R	probably benign	Het
Odf3	A	G	7: 140,849,462	Y168C	probably damaging	Het
Olfr1145	A	G	2: 87,810,590	T257A	probably damaging	Het
Olfr286	A	C	15: 98,227,544	F34V	possibly damaging	Het
P2rx2	T	C	5: 110,340,927	N224D	probably damaging	Het
P2rx5	A	T	11: 73,171,779	E438V	probably benign	Het
Paip1	C	A	13: 119,449,889		probably benign	Het
Pik3c2g	T	A	6: 139,768,779	V219E	probably damaging	Het
Ppp1r12b	T	C	1: 134,873,951	E509G	probably damaging	Het
Ppp1r15a	T	C	7: 45,525,373	S4G	probably benign	Het
Ppp5c	T	C	7: 17,009,022	S224G	probably benign	Het
Prr30	T	G	14: 101,198,443	I228L	probably benign	Het
Purg	A	G	8: 33,387,314	I327V	possibly damaging	Het
Ralb	T	C	1: 119,475,915	T161A	probably benign	Het
Ripor3	T	C	2: 167,992,813	R253G	probably benign	Het
Scgb2b6	T	C	7: 31,617,832		noncoding transcript	Het
Setd5	G	T	6: 113,151,399	G1438W	probably damaging	Het
Sh3rf3	T	A	10: 58,813,723	L50Q	possibly damaging	Het
Sipa1l2	G	T	8: 125,473,601	T662K	probably damaging	Het
Skint5	A	G	4: 113,580,528	L1021S	unknown	Het
Slc22a23	T	C	13: 34,203,941	S391G	probably benign	Het
Slc4a5	G	A	6: 83,271,017	V402I	probably benign	Het
Slco4c1	G	A	1: 96,841,228	P303L	probably damaging	Het
Spink5	A	T	18: 44,020,841	*1018C	probably null	Het
Stag3	T	A	5: 138,296,694		probably null	Het
Tmem117	T	C	15: 95,094,688	F410L	probably damaging	Het
Tmod1	A	G	4: 46,090,920	K158E	possibly damaging	Het
Tpsb2	GGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTG	17: 25,366,562		probably benign	Het
Traf4	G	A	11: 78,161,520	Q100*	probably null	Het
Trpc4	A	G	3: 54,302,218	Y668C	probably damaging	Het
Ttn	T	A	2: 76,767,583	N11335I	possibly damaging	Het
Uhrf1bp1l	T	G	10: 89,794,484	V382G	probably damaging	Het
Usp39	A	T	6: 72,325,682	V463E	probably benign	Het
Vmn1r6	A	C	6: 57,002,698	Y115S	probably benign	Het
Vmn2r44	A	G	7: 8,380,301	I98T	possibly damaging	Het
Zfp462	A	G	4: 55,010,668	Y878C	probably damaging	Het
Zfp474	T	C	18: 52,638,431	I52T	possibly damaging	Het

Other mutations in Amotl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02157:Amotl1	APN	9	14571715	splice site	probably benign
IGL02750:Amotl1	APN	9	14548791	missense	probably benign	0.34
R0071:Amotl1	UTSW	9	14548773	missense	probably benign	0.25
R0071:Amotl1	UTSW	9	14548773	missense	probably benign	0.25
R0094:Amotl1	UTSW	9	14575387	missense	probably benign	0.12
R0094:Amotl1	UTSW	9	14575387	missense	probably benign	0.12
R0178:Amotl1	UTSW	9	14548773	missense	probably benign	0.25
R0179:Amotl1	UTSW	9	14548773	missense	probably benign	0.25
R0853:Amotl1	UTSW	9	14592778	missense	probably damaging	0.99
R0941:Amotl1	UTSW	9	14596558	missense	possibly damaging	0.90
R1447:Amotl1	UTSW	9	14555742	missense	probably benign
R1689:Amotl1	UTSW	9	14593222	missense	probably damaging	0.99
R1692:Amotl1	UTSW	9	14551722	missense	possibly damaging	0.94
R1858:Amotl1	UTSW	9	14575401	missense	probably benign	0.34
R2158:Amotl1	UTSW	9	14575169	missense	probably benign	0.00
R2184:Amotl1	UTSW	9	14575390	missense	probably benign	0.00
R3040:Amotl1	UTSW	9	14572773	missense	probably benign	0.42
R4226:Amotl1	UTSW	9	14593678	missense	probably benign	0.00
R4776:Amotl1	UTSW	9	14593373	nonsense	probably null
R5283:Amotl1	UTSW	9	14558484	missense	probably damaging	1.00
R5478:Amotl1	UTSW	9	14592752	critical splice donor site	probably null
R5562:Amotl1	UTSW	9	14575297	missense	possibly damaging	0.56
R5970:Amotl1	UTSW	9	14596528	missense	probably damaging	1.00
R6265:Amotl1	UTSW	9	14571655	missense	possibly damaging	0.93
R6974:Amotl1	UTSW	9	14644920	nonsense	probably null
R7016:Amotl1	UTSW	9	14593699	missense	probably damaging	0.99
R7058:Amotl1	UTSW	9	14575236	missense	possibly damaging	0.94
R7317:Amotl1	UTSW	9	14575219	missense	probably benign	0.02
R7730:Amotl1	UTSW	9	14555763	missense	possibly damaging	0.53
R7994:Amotl1	UTSW	9	14593361	missense	probably damaging	0.98
R7996:Amotl1	UTSW	9	14593705	missense	possibly damaging	0.94
R8077:Amotl1	UTSW	9	14550502	missense	probably damaging	1.00
R8116:Amotl1	UTSW	9	14555572	critical splice donor site	probably null
R8140:Amotl1	UTSW	9	14572715	splice site	probably null
R8362:Amotl1	UTSW	9	14644922	missense	probably benign	0.26
R8364:Amotl1	UTSW	9	14644922	missense	probably benign	0.26
R8526:Amotl1	UTSW	9	14562196	missense	probably damaging	1.00
R8855:Amotl1	UTSW	9	14555573	critical splice donor site	probably null
R8904:Amotl1	UTSW	9	14558565	missense	probably damaging	1.00
R9179:Amotl1	UTSW	9	14550491	missense	possibly damaging	0.89
R9228:Amotl1	UTSW	9	14593024	missense	possibly damaging	0.69
R9361:Amotl1	UTSW	9	14593381	missense	probably benign	0.03
R9513:Amotl1	UTSW	9	14614767	missense	probably benign
R9563:Amotl1	UTSW	9	14562217	missense	possibly damaging	0.95
R9564:Amotl1	UTSW	9	14562217	missense	possibly damaging	0.95
R9620:Amotl1	UTSW	9	14548673	missense	probably damaging	1.00
R9654:Amotl1	UTSW	9	14551685	missense	probably benign	0.19
R9750:Amotl1	UTSW	9	14592806	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CATGTAATAAGTGTGGCTAAGGGGC -3'
(R):5'- TGTTACAGCGGCTGATCCAG -3'

Sequencing Primer
(F):5'- GTCCCTGCTGCTGTTGCTG -3'
(R):5'- TCCAGGAACAACTGCGCTATGG -3'

Posted On

2016-03-01