Incidental Mutation 'R4854:Col6a5'
ID373806
Institutional Source Beutler Lab
Gene Symbol Col6a5
Ensembl Gene ENSMUSG00000091345
Gene Namecollagen, type VI, alpha 5
SynonymsGm7455, Col6a5
MMRRC Submission 042465-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.874) question?
Stock #R4854 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105856078-105960643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105898751 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1702 (T1702A)
Ref Sequence ENSEMBL: ENSMUSP00000139398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165165] [ENSMUST00000190193]
Predicted Effect probably benign
Transcript: ENSMUST00000165165
AA Change: T1702A

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131146
Gene: ENSMUSG00000091345
AA Change: T1702A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.8e-24 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 2.23e-20 SMART
VWA 472 649 6.84e-39 SMART
VWA 658 834 1.52e-45 SMART
VWA 844 1024 2.44e-44 SMART
VWA 1035 1208 2.95e-20 SMART
Pfam:Collagen 1425 1478 3.3e-8 PFAM
low complexity region 1493 1508 N/A INTRINSIC
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 9.6e-10 PFAM
low complexity region 1711 1730 N/A INTRINSIC
low complexity region 1739 1757 N/A INTRINSIC
VWA 1788 1964 1.99e-17 SMART
VWA 1994 2173 5.98e-21 SMART
VWA 2319 2513 4.4e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190193
AA Change: T1702A

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139398
Gene: ENSMUSG00000091345
AA Change: T1702A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.1e-26 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 1.4e-22 SMART
VWA 472 649 4.4e-41 SMART
VWA 658 834 9.5e-48 SMART
VWA 844 1024 1.6e-46 SMART
VWA 1035 1208 1.9e-22 SMART
Pfam:Collagen 1425 1478 1.2e-6 PFAM
Pfam:Collagen 1457 1530 5.9e-6 PFAM
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 3.6e-8 PFAM
Pfam:Collagen 1631 1691 8.4e-6 PFAM
Pfam:Collagen 1706 1764 6.6e-6 PFAM
VWA 1788 1964 1.2e-19 SMART
VWA 1994 2173 3.7e-23 SMART
VWA 2319 2513 2.8e-21 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collagen superfamily of proteins. The encoded protein contains multiple von Willebrand factor A-like domains and may interact with the alpha 1 and alpha 2 chains of collagen VI to form the complete collagen VI trimer. Polymorphisms in this gene may be linked to dermal phenotypes, such as eczema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik T A 9: 22,208,037 noncoding transcript Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abl1 T C 2: 31,779,010 Y110H probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Agbl3 G A 6: 34,785,284 R73Q probably damaging Het
Agl C T 3: 116,778,618 probably null Het
Amotl1 G A 9: 14,593,451 Q191* probably null Het
Apbb1ip A G 2: 22,853,202 K349E possibly damaging Het
Arhgap10 G A 8: 77,420,089 Q229* probably null Het
Aspm C T 1: 139,478,072 Q1566* probably null Het
B3gnt3 G A 8: 71,692,873 R284C probably damaging Het
Brd4 A G 17: 32,220,237 V423A probably damaging Het
Btbd9 A T 17: 30,524,865 I221N probably damaging Het
Camp A G 9: 109,847,451 V168A probably benign Het
Cd1d2 T A 3: 86,989,249 probably null Het
Cdkn2d A T 9: 21,290,927 V8D probably benign Het
Clec4g T C 8: 3,716,534 N256D probably damaging Het
Clspn A G 4: 126,575,950 I771V probably benign Het
Cntn6 A G 6: 104,859,475 E862G possibly damaging Het
Dnah7a T C 1: 53,706,729 probably benign Het
Dubr T C 16: 50,732,523 noncoding transcript Het
Dusp26 G A 8: 31,094,137 V91M probably damaging Het
Edc4 A T 8: 105,887,925 probably benign Het
F5 C T 1: 164,192,146 A730V probably damaging Het
Foxf1 A G 8: 121,086,814 T358A probably benign Het
Frem1 A T 4: 82,916,758 N1810K possibly damaging Het
Galc A T 12: 98,256,877 F87I probably damaging Het
Gars A G 6: 55,046,418 D66G probably damaging Het
Gbp11 G A 5: 105,325,508 L460F probably damaging Het
Gdf7 T C 12: 8,298,014 I436V probably damaging Het
Gigyf2 C T 1: 87,354,413 probably benign Het
Gm12239 T C 11: 56,015,953 noncoding transcript Het
Gm5592 A C 7: 41,217,471 probably benign Het
Gp2 A T 7: 119,452,199 D264E possibly damaging Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Grid1 A G 14: 35,321,641 I318V probably benign Het
Grm2 C A 9: 106,654,132 V53F possibly damaging Het
Gtpbp1 T C 15: 79,719,205 S632P probably benign Het
H2-M1 A G 17: 36,670,058 F329L probably benign Het
Hecw1 T A 13: 14,316,892 D92V probably benign Het
Hgh1 T C 15: 76,369,182 L76P probably damaging Het
Idi2 C A 13: 8,957,843 N63K probably benign Het
Ift122 A G 6: 115,862,746 T25A possibly damaging Het
Itgb2l A T 16: 96,426,117 C575* probably null Het
Jup A G 11: 100,383,041 S225P possibly damaging Het
Kcng3 A T 17: 83,588,306 C244S probably damaging Het
Klhl2 T A 8: 64,834,459 M46L possibly damaging Het
Ksr1 A T 11: 79,027,702 I460N probably damaging Het
Lama3 T A 18: 12,411,542 F314Y probably benign Het
Lbp T C 2: 158,327,518 V421A possibly damaging Het
Lcp1 G A 14: 75,200,489 G113D probably damaging Het
Lrp1b A T 2: 41,111,077 L2045H probably damaging Het
Mbd2 G T 18: 70,568,735 D107Y unknown Het
Ms4a14 C T 19: 11,310,369 V96I possibly damaging Het
N4bp2l2 C T 5: 150,662,051 E155K probably benign Het
Nbeal2 T G 9: 110,631,396 H1790P probably damaging Het
Nsg2 G A 11: 32,031,806 G84R probably benign Het
Odf3 A G 7: 140,849,462 Y168C probably damaging Het
Olfr1145 A G 2: 87,810,590 T257A probably damaging Het
Olfr286 A C 15: 98,227,544 F34V possibly damaging Het
P2rx2 T C 5: 110,340,927 N224D probably damaging Het
P2rx5 A T 11: 73,171,779 E438V probably benign Het
Paip1 C A 13: 119,449,889 probably benign Het
Pik3c2g T A 6: 139,768,779 V219E probably damaging Het
Ppp1r12b T C 1: 134,873,951 E509G probably damaging Het
Ppp1r15a T C 7: 45,525,373 S4G probably benign Het
Ppp5c T C 7: 17,009,022 S224G probably benign Het
Prr30 T G 14: 101,198,443 I228L probably benign Het
Purg A G 8: 33,387,314 I327V possibly damaging Het
Ralb T C 1: 119,475,915 T161A probably benign Het
Ripor3 T C 2: 167,992,813 R253G probably benign Het
Scgb2b6 T C 7: 31,617,832 noncoding transcript Het
Setd5 G T 6: 113,151,399 G1438W probably damaging Het
Sh3rf3 T A 10: 58,813,723 L50Q possibly damaging Het
Sipa1l2 G T 8: 125,473,601 T662K probably damaging Het
Skint5 A G 4: 113,580,528 L1021S unknown Het
Slc22a23 T C 13: 34,203,941 S391G probably benign Het
Slc4a5 G A 6: 83,271,017 V402I probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Spink5 A T 18: 44,020,841 *1018C probably null Het
Stag3 T A 5: 138,296,694 probably null Het
Tmem117 T C 15: 95,094,688 F410L probably damaging Het
Tmod1 A G 4: 46,090,920 K158E possibly damaging Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Traf4 G A 11: 78,161,520 Q100* probably null Het
Trpc4 A G 3: 54,302,218 Y668C probably damaging Het
Ttn T A 2: 76,767,583 N11335I possibly damaging Het
Uhrf1bp1l T G 10: 89,794,484 V382G probably damaging Het
Usp39 A T 6: 72,325,682 V463E probably benign Het
Vmn1r6 A C 6: 57,002,698 Y115S probably benign Het
Vmn2r44 A G 7: 8,380,301 I98T possibly damaging Het
Zfp462 A G 4: 55,010,668 Y878C probably damaging Het
Zfp474 T C 18: 52,638,431 I52T possibly damaging Het
Other mutations in Col6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Col6a5 APN 9 105882683 missense probably damaging 1.00
IGL01462:Col6a5 APN 9 105946075 missense unknown
IGL01530:Col6a5 APN 9 105915186 splice site probably benign
IGL01717:Col6a5 APN 9 105940273 missense unknown
IGL01859:Col6a5 APN 9 105930961 nonsense probably null
IGL01945:Col6a5 APN 9 105928290 missense unknown
IGL01985:Col6a5 APN 9 105937283 missense unknown
IGL02128:Col6a5 APN 9 105939894 missense unknown
IGL02170:Col6a5 APN 9 105928422 missense unknown
IGL02224:Col6a5 APN 9 105864335 missense probably damaging 1.00
IGL02246:Col6a5 APN 9 105911107 nonsense probably null
IGL02304:Col6a5 APN 9 105928414 missense unknown
IGL02338:Col6a5 APN 9 105878630 missense probably damaging 1.00
IGL02375:Col6a5 APN 9 105906113 missense unknown
IGL02660:Col6a5 APN 9 105936886 missense unknown
IGL02829:Col6a5 APN 9 105934307 missense unknown
IGL02882:Col6a5 APN 9 105934321 missense unknown
IGL02973:Col6a5 APN 9 105925821 missense unknown
IGL03089:Col6a5 APN 9 105933839 missense unknown
IGL03100:Col6a5 APN 9 105937313 missense unknown
IGL03257:Col6a5 APN 9 105881873 missense possibly damaging 0.95
FR4340:Col6a5 UTSW 9 105934174 missense unknown
FR4342:Col6a5 UTSW 9 105934174 missense unknown
FR4589:Col6a5 UTSW 9 105934174 missense unknown
PIT4131001:Col6a5 UTSW 9 105881914 missense probably damaging 0.98
R0147:Col6a5 UTSW 9 105925794 missense unknown
R0549:Col6a5 UTSW 9 105904579 splice site probably benign
R0622:Col6a5 UTSW 9 105925852 missense unknown
R0628:Col6a5 UTSW 9 105912450 splice site probably null
R0635:Col6a5 UTSW 9 105928606 missense unknown
R0644:Col6a5 UTSW 9 105948324 critical splice donor site probably null
R0828:Col6a5 UTSW 9 105862064 critical splice acceptor site probably null
R0972:Col6a5 UTSW 9 105940285 missense unknown
R1065:Col6a5 UTSW 9 105881783 missense probably damaging 0.99
R1142:Col6a5 UTSW 9 105934317 missense unknown
R1169:Col6a5 UTSW 9 105896974 splice site probably null
R1522:Col6a5 UTSW 9 105939994 missense unknown
R1646:Col6a5 UTSW 9 105862749 nonsense probably null
R1719:Col6a5 UTSW 9 105931293 missense unknown
R1759:Col6a5 UTSW 9 105930846 missense unknown
R1780:Col6a5 UTSW 9 105936878 missense unknown
R1812:Col6a5 UTSW 9 105928054 missense unknown
R1838:Col6a5 UTSW 9 105864833 missense probably benign 0.28
R1839:Col6a5 UTSW 9 105864833 missense probably benign 0.28
R1863:Col6a5 UTSW 9 105940201 missense unknown
R1900:Col6a5 UTSW 9 105931213 missense unknown
R1951:Col6a5 UTSW 9 105936957 missense unknown
R2024:Col6a5 UTSW 9 105936994 missense unknown
R2126:Col6a5 UTSW 9 105945600 missense unknown
R2319:Col6a5 UTSW 9 105937218 missense unknown
R2344:Col6a5 UTSW 9 105928537 missense unknown
R2483:Col6a5 UTSW 9 105864148 missense probably damaging 1.00
R3176:Col6a5 UTSW 9 105911107 nonsense probably null
R3276:Col6a5 UTSW 9 105911107 nonsense probably null
R3438:Col6a5 UTSW 9 105875792 missense possibly damaging 0.88
R3791:Col6a5 UTSW 9 105864669 missense probably damaging 0.99
R3840:Col6a5 UTSW 9 105928611 missense unknown
R3886:Col6a5 UTSW 9 105930930 missense unknown
R3941:Col6a5 UTSW 9 105939834 missense unknown
R4194:Col6a5 UTSW 9 105945914 missense unknown
R4399:Col6a5 UTSW 9 105888965 missense possibly damaging 0.75
R4421:Col6a5 UTSW 9 105928473 missense unknown
R4450:Col6a5 UTSW 9 105904521 missense unknown
R4491:Col6a5 UTSW 9 105940012 missense unknown
R4582:Col6a5 UTSW 9 105862764 missense probably benign 0.17
R4693:Col6a5 UTSW 9 105937172 missense unknown
R4787:Col6a5 UTSW 9 105931081 missense unknown
R4789:Col6a5 UTSW 9 105937335 missense unknown
R4791:Col6a5 UTSW 9 105930784 missense unknown
R4792:Col6a5 UTSW 9 105930784 missense unknown
R4817:Col6a5 UTSW 9 105934298 missense unknown
R4927:Col6a5 UTSW 9 105933964 missense unknown
R4969:Col6a5 UTSW 9 105864607 missense probably damaging 1.00
R5037:Col6a5 UTSW 9 105928138 missense unknown
R5118:Col6a5 UTSW 9 105937005 missense unknown
R5144:Col6a5 UTSW 9 105889283 missense probably damaging 1.00
R5145:Col6a5 UTSW 9 105934245 missense unknown
R5160:Col6a5 UTSW 9 105931009 missense unknown
R5182:Col6a5 UTSW 9 105857332 nonsense probably null
R5234:Col6a5 UTSW 9 105864205 missense probably damaging 1.00
R5252:Col6a5 UTSW 9 105940290 missense unknown
R5290:Col6a5 UTSW 9 105946083 missense unknown
R5313:Col6a5 UTSW 9 105945544 missense unknown
R5321:Col6a5 UTSW 9 105928465 missense unknown
R5466:Col6a5 UTSW 9 105931083 missense unknown
R5540:Col6a5 UTSW 9 105862776 missense probably benign 0.44
R5669:Col6a5 UTSW 9 105925998 missense unknown
R5789:Col6a5 UTSW 9 105864608 missense possibly damaging 0.91
R5801:Col6a5 UTSW 9 105948367 missense unknown
R5827:Col6a5 UTSW 9 105928120 nonsense probably null
R5839:Col6a5 UTSW 9 105945393 critical splice donor site probably null
R5908:Col6a5 UTSW 9 105862801 missense possibly damaging 0.88
R5970:Col6a5 UTSW 9 105945847 missense unknown
R6045:Col6a5 UTSW 9 105925918 missense unknown
R6107:Col6a5 UTSW 9 105892272 nonsense probably null
R6168:Col6a5 UTSW 9 105875787 critical splice donor site probably null
R6315:Col6a5 UTSW 9 105881970 missense probably damaging 1.00
R6317:Col6a5 UTSW 9 105889067 missense probably damaging 1.00
R6414:Col6a5 UTSW 9 105892266 splice site probably null
R6434:Col6a5 UTSW 9 105937345 missense unknown
R6456:Col6a5 UTSW 9 105945477 missense unknown
R6698:Col6a5 UTSW 9 105934175 missense unknown
R6876:Col6a5 UTSW 9 105937307 missense unknown
R6882:Col6a5 UTSW 9 105940270 nonsense probably null
R6928:Col6a5 UTSW 9 105939919 missense unknown
R7024:Col6a5 UTSW 9 105912475 nonsense probably null
R7038:Col6a5 UTSW 9 105945738 missense unknown
R7082:Col6a5 UTSW 9 105931239 missense unknown
R7158:Col6a5 UTSW 9 105864208 missense possibly damaging 0.90
R7211:Col6a5 UTSW 9 105928164 missense unknown
R7431:Col6a5 UTSW 9 105928269 missense unknown
R7440:Col6a5 UTSW 9 105881431 nonsense probably null
R7502:Col6a5 UTSW 9 105875876 missense probably benign 0.05
R7577:Col6a5 UTSW 9 105864688 nonsense probably null
R7582:Col6a5 UTSW 9 105945426 missense unknown
R7641:Col6a5 UTSW 9 105881426 nonsense probably null
R7762:Col6a5 UTSW 9 105931324 missense unknown
R7793:Col6a5 UTSW 9 105898735 missense probably damaging 1.00
R7821:Col6a5 UTSW 9 105864259 missense probably damaging 1.00
R7848:Col6a5 UTSW 9 105928186 missense unknown
R7897:Col6a5 UTSW 9 105889183 missense possibly damaging 0.96
R7904:Col6a5 UTSW 9 105928521 missense unknown
R8015:Col6a5 UTSW 9 105881741 missense possibly damaging 0.65
R8100:Col6a5 UTSW 9 105878640 missense probably damaging 1.00
R8131:Col6a5 UTSW 9 105901616 missense unknown
RF013:Col6a5 UTSW 9 105878597 frame shift probably null
X0054:Col6a5 UTSW 9 105915158 missense unknown
X0058:Col6a5 UTSW 9 105881778 nonsense probably null
Z1088:Col6a5 UTSW 9 105926067 missense unknown
Z1177:Col6a5 UTSW 9 105930785 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAAAGTCCAATGATGCTGG -3'
(R):5'- ACAGTCTCCCCATCTAGATAGC -3'

Sequencing Primer
(F):5'- GTCCAATGATGCTGGATTAGTAACAG -3'
(R):5'- CCCCATCTAGATAGCTTTTGAGAAAC -3'
Posted On2016-03-01