Incidental Mutation 'R4854:Nbeal2'
ID373809
Institutional Source Beutler Lab
Gene Symbol Nbeal2
Ensembl Gene ENSMUSG00000056724
Gene Nameneurobeachin-like 2
Synonyms1110014F23Rik
MMRRC Submission 042465-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R4854 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110624789-110654161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 110631396 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 1790 (H1790P)
Ref Sequence ENSEMBL: ENSMUSP00000121373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133191] [ENSMUST00000167320] [ENSMUST00000196488]
Predicted Effect probably benign
Transcript: ENSMUST00000123996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129095
Predicted Effect unknown
Transcript: ENSMUST00000130024
AA Change: H1078P
SMART Domains Protein: ENSMUSP00000118061
Gene: ENSMUSG00000056724
AA Change: H1078P

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 236 248 N/A INTRINSIC
Pfam:DUF4704 345 607 2.5e-29 PFAM
low complexity region 649 664 N/A INTRINSIC
low complexity region 804 819 N/A INTRINSIC
Pfam:DUF4800 872 1138 9.9e-113 PFAM
low complexity region 1164 1193 N/A INTRINSIC
Pfam:PH_BEACH 1204 1291 2.2e-21 PFAM
Beach 1343 1623 5.2e-205 SMART
WD40 1721 1766 1.03e1 SMART
WD40 1769 1808 6.19e-5 SMART
WD40 1820 1859 1.02e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000131017
AA Change: H149P
SMART Domains Protein: ENSMUSP00000114660
Gene: ENSMUSG00000056724
AA Change: H149P

DomainStartEndE-ValueType
Pfam:DUF4800 1 209 7.5e-97 PFAM
low complexity region 235 264 N/A INTRINSIC
Pfam:PH_BEACH 275 362 1e-21 PFAM
Beach 414 694 5.2e-205 SMART
WD40 762 807 1.03e1 SMART
WD40 810 849 6.19e-5 SMART
WD40 861 900 1.02e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133191
AA Change: H1790P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724
AA Change: H1790P

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
Pfam:Laminin_G_3 578 818 5.9e-8 PFAM
low complexity region 1014 1028 N/A INTRINSIC
low complexity region 1128 1136 N/A INTRINSIC
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1359 1375 N/A INTRINSIC
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1621 1647 N/A INTRINSIC
low complexity region 1875 1904 N/A INTRINSIC
Pfam:PH_BEACH 1908 2002 6.2e-28 PFAM
Beach 2054 2334 5.2e-205 SMART
WD40 2432 2477 1.03e1 SMART
WD40 2480 2519 6.19e-5 SMART
WD40 2531 2570 1.02e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153960
Predicted Effect probably damaging
Transcript: ENSMUST00000167320
AA Change: H1797P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724
AA Change: H1797P

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 763 775 N/A INTRINSIC
Pfam:DUF4704 872 1148 9.2e-32 PFAM
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1366 1382 N/A INTRINSIC
low complexity region 1522 1537 N/A INTRINSIC
Pfam:DUF4800 1590 1856 1.5e-112 PFAM
low complexity region 1882 1911 N/A INTRINSIC
Pfam:PH_BEACH 1922 2009 3.1e-21 PFAM
Beach 2061 2341 5.2e-205 SMART
WD40 2439 2484 1.03e1 SMART
WD40 2487 2526 6.19e-5 SMART
WD40 2538 2577 1.02e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184024
Predicted Effect probably damaging
Transcript: ENSMUST00000196488
AA Change: H1763P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724
AA Change: H1763P

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 487 495 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
Pfam:Laminin_G_3 551 791 5.3e-6 PFAM
low complexity region 987 1001 N/A INTRINSIC
low complexity region 1101 1109 N/A INTRINSIC
low complexity region 1122 1136 N/A INTRINSIC
low complexity region 1332 1348 N/A INTRINSIC
low complexity region 1488 1503 N/A INTRINSIC
low complexity region 1594 1620 N/A INTRINSIC
low complexity region 1848 1877 N/A INTRINSIC
Pfam:PH_BEACH 1881 1975 3.1e-25 PFAM
Beach 2027 2307 3.8e-209 SMART
WD40 2405 2450 6.3e-2 SMART
WD40 2453 2492 3.8e-7 SMART
WD40 2504 2543 6.5e-8 SMART
Meta Mutation Damage Score 0.3377 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik T A 9: 22,208,037 noncoding transcript Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abl1 T C 2: 31,779,010 Y110H probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Agbl3 G A 6: 34,785,284 R73Q probably damaging Het
Agl C T 3: 116,778,618 probably null Het
Amotl1 G A 9: 14,593,451 Q191* probably null Het
Apbb1ip A G 2: 22,853,202 K349E possibly damaging Het
Arhgap10 G A 8: 77,420,089 Q229* probably null Het
Aspm C T 1: 139,478,072 Q1566* probably null Het
B3gnt3 G A 8: 71,692,873 R284C probably damaging Het
Brd4 A G 17: 32,220,237 V423A probably damaging Het
Btbd9 A T 17: 30,524,865 I221N probably damaging Het
Camp A G 9: 109,847,451 V168A probably benign Het
Cd1d2 T A 3: 86,989,249 probably null Het
Cdkn2d A T 9: 21,290,927 V8D probably benign Het
Clec4g T C 8: 3,716,534 N256D probably damaging Het
Clspn A G 4: 126,575,950 I771V probably benign Het
Cntn6 A G 6: 104,859,475 E862G possibly damaging Het
Col6a5 T C 9: 105,898,751 T1702A probably benign Het
Dnah7a T C 1: 53,706,729 probably benign Het
Dubr T C 16: 50,732,523 noncoding transcript Het
Dusp26 G A 8: 31,094,137 V91M probably damaging Het
Edc4 A T 8: 105,887,925 probably benign Het
F5 C T 1: 164,192,146 A730V probably damaging Het
Foxf1 A G 8: 121,086,814 T358A probably benign Het
Frem1 A T 4: 82,916,758 N1810K possibly damaging Het
Galc A T 12: 98,256,877 F87I probably damaging Het
Gars A G 6: 55,046,418 D66G probably damaging Het
Gbp11 G A 5: 105,325,508 L460F probably damaging Het
Gdf7 T C 12: 8,298,014 I436V probably damaging Het
Gigyf2 C T 1: 87,354,413 probably benign Het
Gm12239 T C 11: 56,015,953 noncoding transcript Het
Gm5592 A C 7: 41,217,471 probably benign Het
Gp2 A T 7: 119,452,199 D264E possibly damaging Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Grid1 A G 14: 35,321,641 I318V probably benign Het
Grm2 C A 9: 106,654,132 V53F possibly damaging Het
Gtpbp1 T C 15: 79,719,205 S632P probably benign Het
H2-M1 A G 17: 36,670,058 F329L probably benign Het
Hecw1 T A 13: 14,316,892 D92V probably benign Het
Hgh1 T C 15: 76,369,182 L76P probably damaging Het
Idi2 C A 13: 8,957,843 N63K probably benign Het
Ift122 A G 6: 115,862,746 T25A possibly damaging Het
Itgb2l A T 16: 96,426,117 C575* probably null Het
Jup A G 11: 100,383,041 S225P possibly damaging Het
Kcng3 A T 17: 83,588,306 C244S probably damaging Het
Klhl2 T A 8: 64,834,459 M46L possibly damaging Het
Ksr1 A T 11: 79,027,702 I460N probably damaging Het
Lama3 T A 18: 12,411,542 F314Y probably benign Het
Lbp T C 2: 158,327,518 V421A possibly damaging Het
Lcp1 G A 14: 75,200,489 G113D probably damaging Het
Lrp1b A T 2: 41,111,077 L2045H probably damaging Het
Mbd2 G T 18: 70,568,735 D107Y unknown Het
Ms4a14 C T 19: 11,310,369 V96I possibly damaging Het
N4bp2l2 C T 5: 150,662,051 E155K probably benign Het
Nsg2 G A 11: 32,031,806 G84R probably benign Het
Odf3 A G 7: 140,849,462 Y168C probably damaging Het
Olfr1145 A G 2: 87,810,590 T257A probably damaging Het
Olfr286 A C 15: 98,227,544 F34V possibly damaging Het
P2rx2 T C 5: 110,340,927 N224D probably damaging Het
P2rx5 A T 11: 73,171,779 E438V probably benign Het
Paip1 C A 13: 119,449,889 probably benign Het
Pik3c2g T A 6: 139,768,779 V219E probably damaging Het
Ppp1r12b T C 1: 134,873,951 E509G probably damaging Het
Ppp1r15a T C 7: 45,525,373 S4G probably benign Het
Ppp5c T C 7: 17,009,022 S224G probably benign Het
Prr30 T G 14: 101,198,443 I228L probably benign Het
Purg A G 8: 33,387,314 I327V possibly damaging Het
Ralb T C 1: 119,475,915 T161A probably benign Het
Ripor3 T C 2: 167,992,813 R253G probably benign Het
Scgb2b6 T C 7: 31,617,832 noncoding transcript Het
Setd5 G T 6: 113,151,399 G1438W probably damaging Het
Sh3rf3 T A 10: 58,813,723 L50Q possibly damaging Het
Sipa1l2 G T 8: 125,473,601 T662K probably damaging Het
Skint5 A G 4: 113,580,528 L1021S unknown Het
Slc22a23 T C 13: 34,203,941 S391G probably benign Het
Slc4a5 G A 6: 83,271,017 V402I probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Spink5 A T 18: 44,020,841 *1018C probably null Het
Stag3 T A 5: 138,296,694 probably null Het
Tmem117 T C 15: 95,094,688 F410L probably damaging Het
Tmod1 A G 4: 46,090,920 K158E possibly damaging Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Traf4 G A 11: 78,161,520 Q100* probably null Het
Trpc4 A G 3: 54,302,218 Y668C probably damaging Het
Ttn T A 2: 76,767,583 N11335I possibly damaging Het
Uhrf1bp1l T G 10: 89,794,484 V382G probably damaging Het
Usp39 A T 6: 72,325,682 V463E probably benign Het
Vmn1r6 A C 6: 57,002,698 Y115S probably benign Het
Vmn2r44 A G 7: 8,380,301 I98T possibly damaging Het
Zfp462 A G 4: 55,010,668 Y878C probably damaging Het
Zfp474 T C 18: 52,638,431 I52T possibly damaging Het
Other mutations in Nbeal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Nbeal2 APN 9 110635869 missense probably damaging 1.00
IGL00784:Nbeal2 APN 9 110629763 splice site probably benign
IGL00826:Nbeal2 APN 9 110626903 missense probably benign
IGL00885:Nbeal2 APN 9 110638661 missense probably damaging 1.00
IGL01348:Nbeal2 APN 9 110629146 missense probably damaging 0.99
IGL01511:Nbeal2 APN 9 110629234 missense probably damaging 1.00
IGL01571:Nbeal2 APN 9 110632758 missense possibly damaging 0.63
IGL01612:Nbeal2 APN 9 110644678 missense probably damaging 1.00
IGL01924:Nbeal2 APN 9 110631414 missense probably benign 0.23
IGL02056:Nbeal2 APN 9 110627324 missense probably benign 0.17
IGL02481:Nbeal2 APN 9 110625995 nonsense probably null
IGL02483:Nbeal2 APN 9 110625995 nonsense probably null
IGL02502:Nbeal2 APN 9 110633768 missense probably damaging 1.00
IGL02631:Nbeal2 APN 9 110630208 missense probably damaging 0.99
IGL02637:Nbeal2 APN 9 110625977 missense possibly damaging 0.62
IGL02727:Nbeal2 APN 9 110639285 splice site probably benign
IGL02887:Nbeal2 APN 9 110628276 missense probably damaging 1.00
IGL02896:Nbeal2 APN 9 110639292 critical splice donor site probably null
IGL03110:Nbeal2 APN 9 110631433 missense probably damaging 1.00
legion UTSW 9 110629179 missense probably damaging 1.00
litigious UTSW 9 110628195 missense probably damaging 1.00
mall UTSW 9 110632886 missense probably damaging 1.00
Mollusca UTSW 9 110645438 intron probably null
schleuter UTSW 9 110628744 missense possibly damaging 0.69
shellfish UTSW 9 110628720 missense probably damaging 1.00
F5770:Nbeal2 UTSW 9 110637937 missense possibly damaging 0.65
R0032:Nbeal2 UTSW 9 110637868 splice site probably benign
R0084:Nbeal2 UTSW 9 110643710 critical splice donor site probably null
R0147:Nbeal2 UTSW 9 110642143 nonsense probably null
R0294:Nbeal2 UTSW 9 110632859 missense probably damaging 1.00
R0310:Nbeal2 UTSW 9 110638163 missense probably damaging 1.00
R0494:Nbeal2 UTSW 9 110627187 missense probably damaging 1.00
R0550:Nbeal2 UTSW 9 110642158 missense probably benign 0.01
R0630:Nbeal2 UTSW 9 110636034 splice site probably benign
R0762:Nbeal2 UTSW 9 110643808 splice site probably benign
R0862:Nbeal2 UTSW 9 110628195 missense probably damaging 1.00
R0864:Nbeal2 UTSW 9 110628195 missense probably damaging 1.00
R1225:Nbeal2 UTSW 9 110632886 missense probably damaging 1.00
R1240:Nbeal2 UTSW 9 110627108 missense probably damaging 0.98
R1450:Nbeal2 UTSW 9 110633672 splice site probably benign
R1519:Nbeal2 UTSW 9 110636305 missense probably damaging 1.00
R1655:Nbeal2 UTSW 9 110632872 missense probably damaging 1.00
R1668:Nbeal2 UTSW 9 110638893 missense probably damaging 1.00
R1705:Nbeal2 UTSW 9 110625196 missense probably damaging 1.00
R1784:Nbeal2 UTSW 9 110630857 nonsense probably null
R1834:Nbeal2 UTSW 9 110627129 missense probably damaging 1.00
R1997:Nbeal2 UTSW 9 110632198 missense probably damaging 1.00
R2013:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2014:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2055:Nbeal2 UTSW 9 110635307 missense possibly damaging 0.92
R2086:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2113:Nbeal2 UTSW 9 110625406 missense probably damaging 1.00
R2167:Nbeal2 UTSW 9 110638308 missense probably damaging 1.00
R2201:Nbeal2 UTSW 9 110630250 missense probably benign 0.16
R2309:Nbeal2 UTSW 9 110626570 missense probably damaging 1.00
R2378:Nbeal2 UTSW 9 110630808 missense probably damaging 0.99
R2945:Nbeal2 UTSW 9 110628068 missense possibly damaging 0.82
R3052:Nbeal2 UTSW 9 110633085 missense possibly damaging 0.93
R3076:Nbeal2 UTSW 9 110631700 missense probably damaging 1.00
R3176:Nbeal2 UTSW 9 110636887 splice site probably benign
R3974:Nbeal2 UTSW 9 110633846 missense probably damaging 1.00
R4183:Nbeal2 UTSW 9 110636675 missense probably benign
R4342:Nbeal2 UTSW 9 110631793 intron probably benign
R4654:Nbeal2 UTSW 9 110632004 missense probably damaging 1.00
R4707:Nbeal2 UTSW 9 110632055 missense probably benign 0.10
R4822:Nbeal2 UTSW 9 110636315 missense possibly damaging 0.82
R4860:Nbeal2 UTSW 9 110635194 missense probably benign 0.00
R4860:Nbeal2 UTSW 9 110635194 missense probably benign 0.00
R4990:Nbeal2 UTSW 9 110634803 missense probably benign 0.10
R4991:Nbeal2 UTSW 9 110638767 missense probably damaging 1.00
R5021:Nbeal2 UTSW 9 110637463 missense probably damaging 0.99
R5057:Nbeal2 UTSW 9 110631005 missense probably damaging 1.00
R5092:Nbeal2 UTSW 9 110626728 splice site probably null
R5161:Nbeal2 UTSW 9 110629868 missense probably benign
R5202:Nbeal2 UTSW 9 110644666 missense probably damaging 0.99
R5217:Nbeal2 UTSW 9 110632090 missense possibly damaging 0.56
R5408:Nbeal2 UTSW 9 110637520 missense possibly damaging 0.91
R5540:Nbeal2 UTSW 9 110631733 missense probably damaging 1.00
R5866:Nbeal2 UTSW 9 110631492 missense probably damaging 1.00
R5925:Nbeal2 UTSW 9 110629880 missense probably benign 0.00
R6057:Nbeal2 UTSW 9 110641877 missense possibly damaging 0.81
R6180:Nbeal2 UTSW 9 110625147 missense probably damaging 1.00
R6191:Nbeal2 UTSW 9 110627990 critical splice donor site probably null
R6232:Nbeal2 UTSW 9 110638734 missense probably damaging 1.00
R6372:Nbeal2 UTSW 9 110628744 missense possibly damaging 0.69
R6423:Nbeal2 UTSW 9 110625994 missense probably damaging 1.00
R6543:Nbeal2 UTSW 9 110644458 missense probably benign
R6648:Nbeal2 UTSW 9 110637642 missense probably damaging 1.00
R6722:Nbeal2 UTSW 9 110632992 missense probably damaging 1.00
R6738:Nbeal2 UTSW 9 110636905 missense possibly damaging 0.93
R6916:Nbeal2 UTSW 9 110626108 missense probably damaging 1.00
R6935:Nbeal2 UTSW 9 110639391 missense probably damaging 1.00
R7022:Nbeal2 UTSW 9 110638618 missense probably damaging 1.00
R7023:Nbeal2 UTSW 9 110638618 missense probably damaging 1.00
R7050:Nbeal2 UTSW 9 110628720 missense probably damaging 1.00
R7072:Nbeal2 UTSW 9 110626051 missense probably benign 0.01
R7073:Nbeal2 UTSW 9 110626109 missense probably damaging 0.99
R7099:Nbeal2 UTSW 9 110645438 intron probably null
R7354:Nbeal2 UTSW 9 110629179 missense probably damaging 1.00
R7394:Nbeal2 UTSW 9 110630189 critical splice donor site probably null
R7397:Nbeal2 UTSW 9 110628032 missense possibly damaging 0.78
R7552:Nbeal2 UTSW 9 110653917 missense probably benign 0.16
R7619:Nbeal2 UTSW 9 110625818 missense probably benign 0.19
V7583:Nbeal2 UTSW 9 110637937 missense possibly damaging 0.65
X0017:Nbeal2 UTSW 9 110644278 missense probably benign 0.02
X0065:Nbeal2 UTSW 9 110644413 splice site probably benign
Z1088:Nbeal2 UTSW 9 110632372 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CCACTTTAAGACTGCTGGGG -3'
(R):5'- CGGTGCACCTATATGACTGG -3'

Sequencing Primer
(F):5'- AGACTGCTGGGGTCTTAAAGTGC -3'
(R):5'- TGGAGACAGCTAATAGGGCAG -3'
Posted On2016-03-01