Mutagenetix > Incidental Mutations

Incidental Mutation 'R4854:Jup'

373816

Institutional Source

Beutler Lab

Gene Symbol

Jup

Ensembl Gene

ENSMUSG00000001552

Gene Name

junction plakoglobin

Synonyms

PG, gamma-catenin, Ctnng, plakoglobin, D930025P04Rik

MMRRC Submission

042465-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4854 (G1)

Quality Score

201

Status

Validated

Chromosome

Chromosomal Location

100368958-100397763 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100383041 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 225 (S225P)

Ref Sequence

ENSEMBL: ENSMUSP00000103026 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001592] [ENSMUST00000107403]

AlphaFold

Q02257

Predicted Effect

possibly damaging
Transcript: ENSMUST00000001592
AA Change: S225P

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000001592
Gene: ENSMUSG00000001552
AA Change: S225P

Domain	Start	End	E-Value	Type
low complexity region	52	63	N/A	INTRINSIC
ARM	132	171	3.58e1	SMART
ARM	172	214	4.03e1	SMART
ARM	215	255	1.07e-4	SMART
ARM	256	297	1.66e-1	SMART
ARM	299	340	1.86e1	SMART
ARM	341	381	9.23e-9	SMART
ARM	382	420	2.29e1	SMART
ARM	422	464	7.34e-3	SMART
ARM	469	510	8.3e-2	SMART
ARM	511	572	7.45e-4	SMART
ARM	573	613	5.35e-5	SMART
ARM	614	654	1.56e1	SMART
low complexity region	708	723	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107403
AA Change: S225P

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000103026
Gene: ENSMUSG00000001552
AA Change: S225P

Domain	Start	End	E-Value	Type
low complexity region	52	63	N/A	INTRINSIC
ARM	132	171	3.58e1	SMART
ARM	172	214	4.03e1	SMART
ARM	215	255	1.07e-4	SMART
ARM	256	297	1.66e-1	SMART
ARM	299	340	1.86e1	SMART
ARM	341	381	9.23e-9	SMART
ARM	382	420	2.29e1	SMART
ARM	422	464	7.34e-3	SMART
ARM	469	510	8.3e-2	SMART
ARM	511	572	7.45e-4	SMART
ARM	573	613	5.35e-5	SMART
ARM	614	654	1.56e1	SMART
low complexity region	708	723	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123903

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128268

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149798

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155746

Meta Mutation Damage Score

0.6695

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.2%

Validation Efficiency

98% (103/105)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die with severe heart defects at embryonic day 10.5-16, depending on genetic background. Mutants that survive to birth exhibit skin blistering and subcorneal acantholysis associated with reduced number of desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810064F22Rik	T	A	9: 22,208,037		noncoding transcript	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abl1	T	C	2: 31,779,010	Y110H	probably damaging	Het
Ablim2	C	T	5: 35,802,422	R73C	possibly damaging	Het
Agbl3	G	A	6: 34,785,284	R73Q	probably damaging	Het
Agl	C	T	3: 116,778,618		probably null	Het
Amotl1	G	A	9: 14,593,451	Q191*	probably null	Het
Apbb1ip	A	G	2: 22,853,202	K349E	possibly damaging	Het
Arhgap10	G	A	8: 77,420,089	Q229*	probably null	Het
Aspm	C	T	1: 139,478,072	Q1566*	probably null	Het
B3gnt3	G	A	8: 71,692,873	R284C	probably damaging	Het
Brd4	A	G	17: 32,220,237	V423A	probably damaging	Het
Btbd9	A	T	17: 30,524,865	I221N	probably damaging	Het
Camp	A	G	9: 109,847,451	V168A	probably benign	Het
Cd1d2	T	A	3: 86,989,249		probably null	Het
Cdkn2d	A	T	9: 21,290,927	V8D	probably benign	Het
Clec4g	T	C	8: 3,716,534	N256D	probably damaging	Het
Clspn	A	G	4: 126,575,950	I771V	probably benign	Het
Cntn6	A	G	6: 104,859,475	E862G	possibly damaging	Het
Col6a5	T	C	9: 105,898,751	T1702A	probably benign	Het
Dnah7a	T	C	1: 53,706,729		probably benign	Het
Dubr	T	C	16: 50,732,523		noncoding transcript	Het
Dusp26	G	A	8: 31,094,137	V91M	probably damaging	Het
Edc4	A	T	8: 105,887,925		probably benign	Het
F5	C	T	1: 164,192,146	A730V	probably damaging	Het
Foxf1	A	G	8: 121,086,814	T358A	probably benign	Het
Frem1	A	T	4: 82,916,758	N1810K	possibly damaging	Het
Galc	A	T	12: 98,256,877	F87I	probably damaging	Het
Gars	A	G	6: 55,046,418	D66G	probably damaging	Het
Gbp11	G	A	5: 105,325,508	L460F	probably damaging	Het
Gdf7	T	C	12: 8,298,014	I436V	probably damaging	Het
Gigyf2	C	T	1: 87,354,413		probably benign	Het
Gm12239	T	C	11: 56,015,953		noncoding transcript	Het
Gm5592	A	C	7: 41,217,471		probably benign	Het
Gp2	A	T	7: 119,452,199	D264E	possibly damaging	Het
Gphn	G	A	12: 78,627,210	V526M	probably damaging	Het
Grid1	A	G	14: 35,321,641	I318V	probably benign	Het
Grm2	C	A	9: 106,654,132	V53F	possibly damaging	Het
Gtpbp1	T	C	15: 79,719,205	S632P	probably benign	Het
H2-M1	A	G	17: 36,670,058	F329L	probably benign	Het
Hecw1	T	A	13: 14,316,892	D92V	probably benign	Het
Hgh1	T	C	15: 76,369,182	L76P	probably damaging	Het
Idi2	C	A	13: 8,957,843	N63K	probably benign	Het
Ift122	A	G	6: 115,862,746	T25A	possibly damaging	Het
Itgb2l	A	T	16: 96,426,117	C575*	probably null	Het
Kcng3	A	T	17: 83,588,306	C244S	probably damaging	Het
Klhl2	T	A	8: 64,834,459	M46L	possibly damaging	Het
Ksr1	A	T	11: 79,027,702	I460N	probably damaging	Het
Lama3	T	A	18: 12,411,542	F314Y	probably benign	Het
Lbp	T	C	2: 158,327,518	V421A	possibly damaging	Het
Lcp1	G	A	14: 75,200,489	G113D	probably damaging	Het
Lrp1b	A	T	2: 41,111,077	L2045H	probably damaging	Het
Mbd2	G	T	18: 70,568,735	D107Y	unknown	Het
Ms4a14	C	T	19: 11,310,369	V96I	possibly damaging	Het
N4bp2l2	C	T	5: 150,662,051	E155K	probably benign	Het
Nbeal2	T	G	9: 110,631,396	H1790P	probably damaging	Het
Nsg2	G	A	11: 32,031,806	G84R	probably benign	Het
Odf3	A	G	7: 140,849,462	Y168C	probably damaging	Het
Olfr1145	A	G	2: 87,810,590	T257A	probably damaging	Het
Olfr286	A	C	15: 98,227,544	F34V	possibly damaging	Het
P2rx2	T	C	5: 110,340,927	N224D	probably damaging	Het
P2rx5	A	T	11: 73,171,779	E438V	probably benign	Het
Paip1	C	A	13: 119,449,889		probably benign	Het
Pik3c2g	T	A	6: 139,768,779	V219E	probably damaging	Het
Ppp1r12b	T	C	1: 134,873,951	E509G	probably damaging	Het
Ppp1r15a	T	C	7: 45,525,373	S4G	probably benign	Het
Ppp5c	T	C	7: 17,009,022	S224G	probably benign	Het
Prr30	T	G	14: 101,198,443	I228L	probably benign	Het
Purg	A	G	8: 33,387,314	I327V	possibly damaging	Het
Ralb	T	C	1: 119,475,915	T161A	probably benign	Het
Ripor3	T	C	2: 167,992,813	R253G	probably benign	Het
Scgb2b6	T	C	7: 31,617,832		noncoding transcript	Het
Setd5	G	T	6: 113,151,399	G1438W	probably damaging	Het
Sh3rf3	T	A	10: 58,813,723	L50Q	possibly damaging	Het
Sipa1l2	G	T	8: 125,473,601	T662K	probably damaging	Het
Skint5	A	G	4: 113,580,528	L1021S	unknown	Het
Slc22a23	T	C	13: 34,203,941	S391G	probably benign	Het
Slc4a5	G	A	6: 83,271,017	V402I	probably benign	Het
Slco4c1	G	A	1: 96,841,228	P303L	probably damaging	Het
Spink5	A	T	18: 44,020,841	*1018C	probably null	Het
Stag3	T	A	5: 138,296,694		probably null	Het
Tmem117	T	C	15: 95,094,688	F410L	probably damaging	Het
Tmod1	A	G	4: 46,090,920	K158E	possibly damaging	Het
Tpsb2	GGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTG	17: 25,366,562		probably benign	Het
Traf4	G	A	11: 78,161,520	Q100*	probably null	Het
Trpc4	A	G	3: 54,302,218	Y668C	probably damaging	Het
Ttn	T	A	2: 76,767,583	N11335I	possibly damaging	Het
Uhrf1bp1l	T	G	10: 89,794,484	V382G	probably damaging	Het
Usp39	A	T	6: 72,325,682	V463E	probably benign	Het
Vmn1r6	A	C	6: 57,002,698	Y115S	probably benign	Het
Vmn2r44	A	G	7: 8,380,301	I98T	possibly damaging	Het
Zfp462	A	G	4: 55,010,668	Y878C	probably damaging	Het
Zfp474	T	C	18: 52,638,431	I52T	possibly damaging	Het

Other mutations in Jup

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01141:Jup	APN	11	100386249	missense	probably benign
IGL01797:Jup	APN	11	100381672	splice site	probably benign
IGL01926:Jup	APN	11	100383586	missense	probably benign	0.00
IGL02030:Jup	APN	11	100376991	missense	probably damaging	0.96
IGL02073:Jup	APN	11	100383389	splice site	probably benign
IGL02218:Jup	APN	11	100381839	missense	probably damaging	1.00
IGL02450:Jup	APN	11	100378357	missense	probably damaging	1.00
IGL02955:Jup	APN	11	100376739	missense	probably benign	0.31
IGL02976:Jup	APN	11	100378366	missense	probably benign	0.40
IGL03023:Jup	APN	11	100380692	splice site	probably benign
Jove	UTSW	11	100386287	missense	probably damaging	1.00
IGL02802:Jup	UTSW	11	100378378	missense	probably benign
PIT4403001:Jup	UTSW	11	100378087	critical splice donor site	probably null
R0426:Jup	UTSW	11	100372401	missense	probably benign	0.02
R0626:Jup	UTSW	11	100376763	missense	probably benign
R1330:Jup	UTSW	11	100372676	missense	probably benign	0.02
R1437:Jup	UTSW	11	100383576	missense	probably benign	0.06
R1448:Jup	UTSW	11	100383200	missense	probably damaging	1.00
R1473:Jup	UTSW	11	100379601	missense	possibly damaging	0.79
R1686:Jup	UTSW	11	100372434	missense	probably damaging	0.96
R1824:Jup	UTSW	11	100374137	nonsense	probably null
R1875:Jup	UTSW	11	100372294	splice site	probably null
R2017:Jup	UTSW	11	100386341	missense	probably benign	0.01
R2989:Jup	UTSW	11	100376841	missense	possibly damaging	0.92
R3881:Jup	UTSW	11	100378381	missense	probably benign
R3882:Jup	UTSW	11	100378381	missense	probably benign
R4176:Jup	UTSW	11	100372461	missense	probably benign	0.03
R4612:Jup	UTSW	11	100381834	missense	probably damaging	0.98
R4808:Jup	UTSW	11	100378192	missense	probably damaging	0.99
R4995:Jup	UTSW	11	100379541	nonsense	probably null
R5133:Jup	UTSW	11	100383115	missense	probably benign	0.02
R5408:Jup	UTSW	11	100376781	missense	probably damaging	1.00
R5641:Jup	UTSW	11	100376806	missense	possibly damaging	0.62
R5991:Jup	UTSW	11	100379569	missense	possibly damaging	0.59
R6431:Jup	UTSW	11	100374341	missense	probably benign	0.01
R6805:Jup	UTSW	11	100383458	missense	probably benign	0.17
R7022:Jup	UTSW	11	100379553	missense	probably damaging	1.00
R7203:Jup	UTSW	11	100381734	missense	probably damaging	1.00
R7399:Jup	UTSW	11	100378351	missense	possibly damaging	0.87
R7707:Jup	UTSW	11	100383052	missense	possibly damaging	0.90
R8017:Jup	UTSW	11	100374197	missense	probably benign	0.34
R8019:Jup	UTSW	11	100374197	missense	probably benign	0.34
R8074:Jup	UTSW	11	100386287	missense	probably damaging	1.00
R8181:Jup	UTSW	11	100376925	missense	probably damaging	1.00
R8326:Jup	UTSW	11	100381745	missense	probably benign	0.33
R8969:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R8970:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R8971:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R9139:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R9140:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R9145:Jup	UTSW	11	100378298	missense	probably benign	0.01
R9168:Jup	UTSW	11	100383393	critical splice donor site	probably null
R9370:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R9372:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R9373:Jup	UTSW	11	100379565	missense	probably damaging	1.00
R9381:Jup	UTSW	11	100379565	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGTTGTCAAAGCTCCACCC -3'
(R):5'- CTCACACACTTCCTCCAGGTAG -3'

Sequencing Primer
(F):5'- CCCAGAGTTGTCAAAGCTCTG -3'
(R):5'- ATGATCGTGAACCAGCTGTC -3'

Posted On

2016-03-01