Incidental Mutation 'R4854:2700049A03Rik'
ID 373819
Institutional Source Beutler Lab
Gene Symbol 2700049A03Rik
Ensembl Gene ENSMUSG00000034601
Gene Name RIKEN cDNA 2700049A03 gene
Synonyms talpid3, Ta3
MMRRC Submission 042465-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4854 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 71183622-71290077 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71211321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 685 (E685V)
Ref Sequence ENSEMBL: ENSMUSP00000118956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]
AlphaFold E9PV87
Predicted Effect possibly damaging
Transcript: ENSMUST00000045907
AA Change: E685V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: E685V

DomainStartEndE-ValueType
Pfam:TALPID3 116 1351 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149564
AA Change: E685V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: E685V

DomainStartEndE-ValueType
Pfam:TALPID3 116 1349 N/A PFAM
Meta Mutation Damage Score 0.1812 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik T A 9: 22,119,333 (GRCm39) noncoding transcript Het
Abl1 T C 2: 31,669,022 (GRCm39) Y110H probably damaging Het
Ablim2 C T 5: 35,959,766 (GRCm39) R73C possibly damaging Het
Agbl3 G A 6: 34,762,219 (GRCm39) R73Q probably damaging Het
Agl C T 3: 116,572,267 (GRCm39) probably null Het
Amotl1 G A 9: 14,504,747 (GRCm39) Q191* probably null Het
Apbb1ip A G 2: 22,743,214 (GRCm39) K349E possibly damaging Het
Arhgap10 G A 8: 78,146,718 (GRCm39) Q229* probably null Het
Aspm C T 1: 139,405,810 (GRCm39) Q1566* probably null Het
B3gnt3 G A 8: 72,145,517 (GRCm39) R284C probably damaging Het
Bltp3b T G 10: 89,630,346 (GRCm39) V382G probably damaging Het
Brd4 A G 17: 32,439,211 (GRCm39) V423A probably damaging Het
Btbd9 A T 17: 30,743,839 (GRCm39) I221N probably damaging Het
Camp A G 9: 109,676,519 (GRCm39) V168A probably benign Het
Cd1d2 T A 3: 86,896,556 (GRCm39) probably null Het
Cdkn2d A T 9: 21,202,223 (GRCm39) V8D probably benign Het
Cimap1a A G 7: 140,429,375 (GRCm39) Y168C probably damaging Het
Clec4g T C 8: 3,766,534 (GRCm39) N256D probably damaging Het
Clspn A G 4: 126,469,743 (GRCm39) I771V probably benign Het
Cntn6 A G 6: 104,836,436 (GRCm39) E862G possibly damaging Het
Col6a5 T C 9: 105,775,950 (GRCm39) T1702A probably benign Het
Dnah7a T C 1: 53,745,888 (GRCm39) probably benign Het
Dubr T C 16: 50,552,886 (GRCm39) noncoding transcript Het
Dusp26 G A 8: 31,584,165 (GRCm39) V91M probably damaging Het
Edc4 A T 8: 106,614,557 (GRCm39) probably benign Het
F5 C T 1: 164,019,715 (GRCm39) A730V probably damaging Het
Foxf1 A G 8: 121,813,553 (GRCm39) T358A probably benign Het
Frem1 A T 4: 82,834,995 (GRCm39) N1810K possibly damaging Het
Galc A T 12: 98,223,136 (GRCm39) F87I probably damaging Het
Gars1 A G 6: 55,023,403 (GRCm39) D66G probably damaging Het
Gbp11 G A 5: 105,473,374 (GRCm39) L460F probably damaging Het
Gdf7 T C 12: 8,348,014 (GRCm39) I436V probably damaging Het
Gigyf2 C T 1: 87,282,135 (GRCm39) probably benign Het
Gm12239 T C 11: 55,906,779 (GRCm39) noncoding transcript Het
Gm5592 A C 7: 40,866,895 (GRCm39) probably benign Het
Gp2 A T 7: 119,051,422 (GRCm39) D264E possibly damaging Het
Gphn G A 12: 78,673,984 (GRCm39) V526M probably damaging Het
Grid1 A G 14: 35,043,598 (GRCm39) I318V probably benign Het
Grm2 C A 9: 106,531,331 (GRCm39) V53F possibly damaging Het
Gtpbp1 T C 15: 79,603,406 (GRCm39) S632P probably benign Het
H2-M1 A G 17: 36,980,950 (GRCm39) F329L probably benign Het
Hecw1 T A 13: 14,491,477 (GRCm39) D92V probably benign Het
Hgh1 T C 15: 76,253,382 (GRCm39) L76P probably damaging Het
Idi2 C A 13: 9,007,879 (GRCm39) N63K probably benign Het
Ift122 A G 6: 115,839,707 (GRCm39) T25A possibly damaging Het
Itgb2l A T 16: 96,227,317 (GRCm39) C575* probably null Het
Jup A G 11: 100,273,867 (GRCm39) S225P possibly damaging Het
Kcng3 A T 17: 83,895,735 (GRCm39) C244S probably damaging Het
Klhl2 T A 8: 65,287,111 (GRCm39) M46L possibly damaging Het
Ksr1 A T 11: 78,918,528 (GRCm39) I460N probably damaging Het
Lama3 T A 18: 12,544,599 (GRCm39) F314Y probably benign Het
Lbp T C 2: 158,169,438 (GRCm39) V421A possibly damaging Het
Lcp1 G A 14: 75,437,929 (GRCm39) G113D probably damaging Het
Lrp1b A T 2: 41,001,089 (GRCm39) L2045H probably damaging Het
Mbd2 G T 18: 70,701,806 (GRCm39) D107Y unknown Het
Ms4a14 C T 19: 11,287,733 (GRCm39) V96I possibly damaging Het
N4bp2l2 C T 5: 150,585,516 (GRCm39) E155K probably benign Het
Nbeal2 T G 9: 110,460,464 (GRCm39) H1790P probably damaging Het
Nsg2 G A 11: 31,981,806 (GRCm39) G84R probably benign Het
Or10ad1b A C 15: 98,125,425 (GRCm39) F34V possibly damaging Het
Or12e10 A G 2: 87,640,934 (GRCm39) T257A probably damaging Het
P2rx2 T C 5: 110,488,793 (GRCm39) N224D probably damaging Het
P2rx5 A T 11: 73,062,605 (GRCm39) E438V probably benign Het
Paip1 C A 13: 119,586,425 (GRCm39) probably benign Het
Pik3c2g T A 6: 139,714,505 (GRCm39) V219E probably damaging Het
Ppp1r12b T C 1: 134,801,689 (GRCm39) E509G probably damaging Het
Ppp1r15a T C 7: 45,174,797 (GRCm39) S4G probably benign Het
Ppp5c T C 7: 16,742,947 (GRCm39) S224G probably benign Het
Prr30 T G 14: 101,435,879 (GRCm39) I228L probably benign Het
Purg A G 8: 33,877,342 (GRCm39) I327V possibly damaging Het
Ralb T C 1: 119,403,645 (GRCm39) T161A probably benign Het
Ripor3 T C 2: 167,834,733 (GRCm39) R253G probably benign Het
Scgb2b6 T C 7: 31,317,257 (GRCm39) noncoding transcript Het
Setd5 G T 6: 113,128,360 (GRCm39) G1438W probably damaging Het
Sh3rf3 T A 10: 58,649,545 (GRCm39) L50Q possibly damaging Het
Sipa1l2 G T 8: 126,200,340 (GRCm39) T662K probably damaging Het
Skint5 A G 4: 113,437,725 (GRCm39) L1021S unknown Het
Slc22a23 T C 13: 34,387,924 (GRCm39) S391G probably benign Het
Slc4a5 G A 6: 83,247,999 (GRCm39) V402I probably benign Het
Slco4c1 G A 1: 96,768,953 (GRCm39) P303L probably damaging Het
Spink5 A T 18: 44,153,908 (GRCm39) *1018C probably null Het
Stag3 T A 5: 138,294,956 (GRCm39) probably null Het
Tmem117 T C 15: 94,992,569 (GRCm39) F410L probably damaging Het
Tmod1 A G 4: 46,090,920 (GRCm39) K158E possibly damaging Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,585,536 (GRCm39) probably benign Het
Traf4 G A 11: 78,052,346 (GRCm39) Q100* probably null Het
Trpc4 A G 3: 54,209,639 (GRCm39) Y668C probably damaging Het
Ttn T A 2: 76,597,927 (GRCm39) N11335I possibly damaging Het
Usp39 A T 6: 72,302,665 (GRCm39) V463E probably benign Het
Vmn1r6 A C 6: 56,979,683 (GRCm39) Y115S probably benign Het
Vmn2r44 A G 7: 8,383,300 (GRCm39) I98T possibly damaging Het
Zfp462 A G 4: 55,010,668 (GRCm39) Y878C probably damaging Het
Zfp474 T C 18: 52,771,503 (GRCm39) I52T possibly damaging Het
Other mutations in 2700049A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:2700049A03Rik APN 12 71,213,893 (GRCm39) missense probably benign 0.00
IGL01107:2700049A03Rik APN 12 71,241,242 (GRCm39) critical splice donor site probably null
IGL01404:2700049A03Rik APN 12 71,211,152 (GRCm39) splice site probably null
IGL01835:2700049A03Rik APN 12 71,213,957 (GRCm39) missense probably benign 0.00
IGL01835:2700049A03Rik APN 12 71,213,955 (GRCm39) nonsense probably null
IGL02122:2700049A03Rik APN 12 71,217,299 (GRCm39) missense possibly damaging 0.93
IGL02140:2700049A03Rik APN 12 71,195,034 (GRCm39) missense probably benign 0.06
IGL02385:2700049A03Rik APN 12 71,201,630 (GRCm39) missense probably damaging 0.98
IGL03181:2700049A03Rik APN 12 71,240,147 (GRCm39) missense possibly damaging 0.51
IGL03253:2700049A03Rik APN 12 71,187,657 (GRCm39) missense probably benign 0.33
IGL03278:2700049A03Rik APN 12 71,205,599 (GRCm39) splice site probably benign
G4846:2700049A03Rik UTSW 12 71,184,683 (GRCm39) missense probably benign
PIT1430001:2700049A03Rik UTSW 12 71,207,160 (GRCm39) missense possibly damaging 0.71
PIT4519001:2700049A03Rik UTSW 12 71,217,440 (GRCm39) missense probably benign 0.05
R0108:2700049A03Rik UTSW 12 71,224,692 (GRCm39) missense probably benign 0.14
R0165:2700049A03Rik UTSW 12 71,213,924 (GRCm39) missense possibly damaging 0.52
R0211:2700049A03Rik UTSW 12 71,262,870 (GRCm39) missense possibly damaging 0.96
R0211:2700049A03Rik UTSW 12 71,262,870 (GRCm39) missense possibly damaging 0.96
R0220:2700049A03Rik UTSW 12 71,195,194 (GRCm39) critical splice donor site probably null
R0352:2700049A03Rik UTSW 12 71,184,804 (GRCm39) missense possibly damaging 0.96
R0468:2700049A03Rik UTSW 12 71,240,084 (GRCm39) missense possibly damaging 0.71
R0508:2700049A03Rik UTSW 12 71,211,162 (GRCm39) missense probably damaging 0.98
R0673:2700049A03Rik UTSW 12 71,224,642 (GRCm39) missense probably damaging 0.97
R0840:2700049A03Rik UTSW 12 71,205,657 (GRCm39) missense probably benign 0.16
R0893:2700049A03Rik UTSW 12 71,266,082 (GRCm39) splice site probably benign
R1244:2700049A03Rik UTSW 12 71,262,918 (GRCm39) missense probably benign 0.25
R1432:2700049A03Rik UTSW 12 71,217,361 (GRCm39) splice site probably null
R1599:2700049A03Rik UTSW 12 71,197,033 (GRCm39) missense probably damaging 0.98
R1732:2700049A03Rik UTSW 12 71,265,995 (GRCm39) missense probably benign 0.18
R1820:2700049A03Rik UTSW 12 71,197,018 (GRCm39) missense possibly damaging 0.51
R1939:2700049A03Rik UTSW 12 71,207,186 (GRCm39) splice site probably null
R1998:2700049A03Rik UTSW 12 71,235,393 (GRCm39) missense possibly damaging 0.86
R2337:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2337:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2340:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2340:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2382:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2382:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2384:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2384:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2445:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2445:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2449:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R2449:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R2512:2700049A03Rik UTSW 12 71,219,945 (GRCm39) missense possibly damaging 0.71
R2872:2700049A03Rik UTSW 12 71,201,530 (GRCm39) splice site probably benign
R3236:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3236:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3237:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3237:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3734:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3734:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3808:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3808:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3809:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3809:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3944:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3944:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3959:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3959:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R3960:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R3960:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4593:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4593:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4595:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4595:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4596:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4596:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4600:2700049A03Rik UTSW 12 71,195,037 (GRCm39) missense possibly damaging 0.67
R4649:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4649:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4652:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4652:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4714:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4714:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4735:2700049A03Rik UTSW 12 71,262,897 (GRCm39) missense possibly damaging 0.88
R4810:2700049A03Rik UTSW 12 71,236,216 (GRCm39) missense possibly damaging 0.51
R4852:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4852:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4854:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4855:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4855:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4884:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4884:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4893:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4893:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4905:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4905:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4915:2700049A03Rik UTSW 12 71,236,420 (GRCm39) missense possibly damaging 0.92
R4919:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4919:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4959:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4959:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R4989:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R4989:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5011:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5011:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5012:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5012:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5118:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5118:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5146:2700049A03Rik UTSW 12 71,289,799 (GRCm39) missense possibly damaging 0.85
R5163:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5163:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5188:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5188:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5189:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71,240,123 (GRCm39) missense possibly damaging 0.93
R5190:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5190:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5290:2700049A03Rik UTSW 12 71,235,565 (GRCm39) missense probably benign 0.00
R5344:2700049A03Rik UTSW 12 71,289,801 (GRCm39) missense probably benign
R5502:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5502:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5503:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5503:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5619:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5619:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5667:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5667:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5669:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5669:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5671:2700049A03Rik UTSW 12 71,211,321 (GRCm39) missense possibly damaging 0.93
R5671:2700049A03Rik UTSW 12 71,211,320 (GRCm39) nonsense probably null
R5725:2700049A03Rik UTSW 12 71,240,093 (GRCm39) missense probably benign 0.05
R5956:2700049A03Rik UTSW 12 71,203,893 (GRCm39) missense possibly damaging 0.86
R6051:2700049A03Rik UTSW 12 71,231,304 (GRCm39) missense possibly damaging 0.84
R6148:2700049A03Rik UTSW 12 71,234,200 (GRCm39) missense possibly damaging 0.71
R6158:2700049A03Rik UTSW 12 71,217,410 (GRCm39) missense possibly damaging 0.51
R6916:2700049A03Rik UTSW 12 71,211,318 (GRCm39) missense possibly damaging 0.86
R7129:2700049A03Rik UTSW 12 71,263,004 (GRCm39) splice site probably null
R7168:2700049A03Rik UTSW 12 71,262,831 (GRCm39) missense probably damaging 0.98
R7193:2700049A03Rik UTSW 12 71,265,963 (GRCm39) critical splice acceptor site probably null
R7200:2700049A03Rik UTSW 12 71,187,680 (GRCm39) missense probably damaging 0.96
R7359:2700049A03Rik UTSW 12 71,236,348 (GRCm39) missense possibly damaging 0.51
R7488:2700049A03Rik UTSW 12 71,197,179 (GRCm39) missense possibly damaging 0.67
R7755:2700049A03Rik UTSW 12 71,236,187 (GRCm39) missense probably benign 0.02
R7757:2700049A03Rik UTSW 12 71,236,187 (GRCm39) missense probably benign 0.02
R7922:2700049A03Rik UTSW 12 71,211,180 (GRCm39) missense possibly damaging 0.83
R7966:2700049A03Rik UTSW 12 71,219,903 (GRCm39) missense probably benign 0.00
R8082:2700049A03Rik UTSW 12 71,188,895 (GRCm39) critical splice donor site probably null
R8311:2700049A03Rik UTSW 12 71,184,815 (GRCm39) unclassified probably benign
R8408:2700049A03Rik UTSW 12 71,236,356 (GRCm39) missense possibly damaging 0.71
R8852:2700049A03Rik UTSW 12 71,231,197 (GRCm39) missense possibly damaging 0.93
R8860:2700049A03Rik UTSW 12 71,231,197 (GRCm39) missense possibly damaging 0.93
R9039:2700049A03Rik UTSW 12 71,213,849 (GRCm39) missense possibly damaging 0.51
R9281:2700049A03Rik UTSW 12 71,205,687 (GRCm39) missense possibly damaging 0.51
R9308:2700049A03Rik UTSW 12 71,231,233 (GRCm39) missense probably benign 0.23
R9385:2700049A03Rik UTSW 12 71,207,966 (GRCm39) missense possibly damaging 0.52
R9412:2700049A03Rik UTSW 12 71,235,457 (GRCm39) missense possibly damaging 0.71
R9643:2700049A03Rik UTSW 12 71,211,189 (GRCm39) missense possibly damaging 0.92
R9676:2700049A03Rik UTSW 12 71,207,905 (GRCm39) missense possibly damaging 0.86
R9776:2700049A03Rik UTSW 12 71,235,448 (GRCm39) missense possibly damaging 0.71
R9789:2700049A03Rik UTSW 12 71,231,357 (GRCm39) missense probably benign
Z1177:2700049A03Rik UTSW 12 71,211,258 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACCTTTTATGTTTCCTAGGTGG -3'
(R):5'- AAACACTGTTCCCTGGCAG -3'

Sequencing Primer
(F):5'- AACATGTTTTGCATTGGTAGGGCC -3'
(R):5'- GATAACGGTACTGAAGCTCTGCTC -3'
Posted On 2016-03-01